View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10545_low_16 (Length: 240)

Name: NF10545_low_16
Description: NF10545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10545_low_16
NF10545_low_16
[»] chr5 (51 HSPs)
chr5 (18-240)||(42291434-42291658)
chr5 (51-170)||(8513506-8513626)
chr5 (51-170)||(5731920-5732040)
chr5 (51-170)||(42086314-42086434)
chr5 (62-170)||(9805002-9805111)
chr5 (70-170)||(12081915-12082015)
chr5 (52-170)||(41163460-41163578)
chr5 (51-170)||(19572711-19572831)
chr5 (51-170)||(25417183-25417303)
chr5 (70-170)||(1538438-1538538)
chr5 (51-170)||(9812859-9812979)
chr5 (51-170)||(12766118-12766238)
chr5 (70-170)||(23383664-23383764)
chr5 (51-170)||(30349566-30349686)
chr5 (75-170)||(40117427-40117522)
chr5 (81-170)||(14588617-14588706)
chr5 (70-171)||(20525845-20525946)
chr5 (81-166)||(39099783-39099868)
chr5 (51-170)||(7866568-7866688)
chr5 (51-170)||(12705001-12705121)
chr5 (70-170)||(20682617-20682717)
chr5 (51-170)||(37263228-37263347)
chr5 (42-166)||(3653918-3654041)
chr5 (70-147)||(7308387-7308464)
chr5 (81-170)||(13664278-13664367)
chr5 (81-170)||(20255387-20255476)
chr5 (81-170)||(43399146-43399235)
chr5 (86-170)||(38897719-38897803)
chr5 (86-170)||(41801000-41801084)
chr5 (47-166)||(18136280-18136404)
chr5 (70-169)||(28862832-28862931)
chr5 (116-170)||(28857002-28857056)
chr5 (116-170)||(28857199-28857253)
chr5 (81-170)||(4016255-4016344)
chr5 (89-170)||(14728109-14728190)
chr5 (47-166)||(9168257-9168376)
chr5 (51-170)||(20692920-20693040)
chr5 (70-170)||(23247352-23247451)
chr5 (70-150)||(30995128-30995208)
chr5 (95-170)||(42861218-42861293)
chr5 (54-166)||(1898991-1899098)
chr5 (96-150)||(14974344-14974398)
chr5 (73-170)||(5079341-5079437)
chr5 (70-127)||(26077148-26077205)
chr5 (121-170)||(40773331-40773380)
chr5 (87-159)||(24875369-24875441)
chr5 (95-166)||(39728419-39728490)
chr5 (51-128)||(28857115-28857193)
chr5 (86-160)||(32874810-32874884)
chr5 (86-167)||(20590022-20590103)
chr5 (86-170)||(11845801-11845885)
[»] chr2 (56 HSPs)
chr2 (51-170)||(41220621-41220741)
chr2 (51-170)||(10823046-10823166)
chr2 (70-166)||(10669598-10669694)
chr2 (70-170)||(25540404-25540504)
chr2 (51-170)||(7747260-7747380)
chr2 (51-170)||(8410117-8410237)
chr2 (51-170)||(11069864-11069984)
chr2 (55-170)||(12455300-12455416)
chr2 (51-170)||(18902530-18902650)
chr2 (71-170)||(27725947-27726046)
chr2 (75-165)||(39201513-39201603)
chr2 (51-170)||(3643887-3644007)
chr2 (51-170)||(22593121-22593239)
chr2 (51-170)||(38962749-38962869)
chr2 (70-170)||(44139490-44139590)
chr2 (51-170)||(44945580-44945699)
chr2 (51-171)||(7787042-7787163)
chr2 (81-170)||(16034954-16035043)
chr2 (42-161)||(331478-331598)
chr2 (70-170)||(2550874-2550974)
chr2 (51-170)||(9360748-9360868)
chr2 (70-170)||(34722686-34722786)
chr2 (51-170)||(35946725-35946844)
chr2 (51-170)||(38005388-38005508)
chr2 (70-170)||(41031906-41032006)
chr2 (75-170)||(16325606-16325701)
chr2 (51-160)||(10026626-10026736)
chr2 (51-170)||(6358151-6358271)
chr2 (86-170)||(14169609-14169693)
chr2 (82-170)||(20116612-20116700)
chr2 (51-170)||(39806885-39807005)
chr2 (51-137)||(21180347-21180434)
chr2 (63-150)||(24179568-24179654)
chr2 (76-162)||(42770659-42770745)
chr2 (58-155)||(45263682-45263780)
chr2 (70-170)||(2528341-2528441)
chr2 (51-170)||(3848914-3849034)
chr2 (63-170)||(12864222-12864330)
chr2 (63-170)||(18649026-18649134)
chr2 (51-166)||(21286430-21286546)
chr2 (70-170)||(34346287-34346387)
chr2 (51-170)||(37560159-37560279)
chr2 (70-171)||(20612533-20612636)
chr2 (42-170)||(19976807-19976936)
chr2 (88-170)||(29653651-29653728)
chr2 (81-170)||(31596432-31596521)
chr2 (70-170)||(5035294-5035394)
chr2 (51-170)||(29422201-29422321)
chr2 (81-136)||(13026445-13026500)
chr2 (51-137)||(15079469-15079556)
chr2 (95-170)||(28525455-28525530)
chr2 (115-170)||(44023346-44023401)
chr2 (123-170)||(44773322-44773369)
chr2 (77-170)||(33005765-33005857)
chr2 (70-170)||(3811691-3811791)
chr2 (51-170)||(15234061-15234181)
[»] chr6 (29 HSPs)
chr6 (51-170)||(21898638-21898758)
chr6 (42-170)||(3601065-3601194)
chr6 (51-170)||(5253223-5253343)
chr6 (70-170)||(19089508-19089608)
chr6 (51-170)||(6606097-6606217)
chr6 (87-170)||(9633625-9633708)
chr6 (70-170)||(8938721-8938821)
chr6 (51-170)||(12635804-12635924)
chr6 (47-170)||(14107358-14107482)
chr6 (75-170)||(12606445-12606540)
chr6 (47-170)||(3587945-3588069)
chr6 (51-170)||(8611974-8612094)
chr6 (51-170)||(29333139-29333258)
chr6 (47-170)||(29444765-29444889)
chr6 (86-170)||(30788853-30788937)
chr6 (76-170)||(31129193-31129287)
chr6 (70-171)||(8149796-8149896)
chr6 (87-171)||(2271302-2271386)
chr6 (51-170)||(13468923-13469043)
chr6 (51-170)||(34954619-34954739)
chr6 (81-170)||(13036004-13036093)
chr6 (70-170)||(8932671-8932771)
chr6 (70-170)||(8944137-8944237)
chr6 (86-170)||(10311469-10311553)
chr6 (116-170)||(14783420-14783474)
chr6 (86-137)||(13391312-13391363)
chr6 (75-170)||(30410460-30410555)
chr6 (70-147)||(33940021-33940098)
chr6 (51-170)||(9179736-9179856)
[»] chr4 (61 HSPs)
chr4 (51-170)||(47078449-47078569)
chr4 (70-170)||(4738629-4738729)
chr4 (70-170)||(38166038-38166138)
chr4 (51-170)||(42722577-42722697)
chr4 (51-170)||(53599051-53599171)
chr4 (51-170)||(2559298-2559418)
chr4 (70-170)||(16450311-16450411)
chr4 (51-170)||(38168248-38168367)
chr4 (75-170)||(43458629-43458724)
chr4 (52-170)||(43468339-43468458)
chr4 (51-170)||(36262767-36262885)
chr4 (51-166)||(3159473-3159589)
chr4 (51-170)||(5472848-5472968)
chr4 (51-170)||(7246646-7246766)
chr4 (51-170)||(13073529-13073649)
chr4 (51-170)||(29895778-29895898)
chr4 (48-170)||(47682382-47682504)
chr4 (86-171)||(40780860-40780945)
chr4 (51-170)||(6779202-6779322)
chr4 (70-170)||(20128320-20128420)
chr4 (51-170)||(36145215-36145335)
chr4 (59-170)||(38075432-38075544)
chr4 (51-170)||(55921025-55921145)
chr4 (51-165)||(8889013-8889128)
chr4 (81-171)||(14859313-14859403)
chr4 (76-166)||(49260669-49260759)
chr4 (55-159)||(20532420-20532525)
chr4 (70-170)||(14124027-14124127)
chr4 (70-170)||(52950093-52950193)
chr4 (96-170)||(14567276-14567350)
chr4 (70-171)||(33647732-33647833)
chr4 (70-168)||(1940779-1940874)
chr4 (51-170)||(15732448-15732568)
chr4 (47-170)||(29588723-29588847)
chr4 (86-162)||(30317260-30317336)
chr4 (47-170)||(48015073-48015197)
chr4 (88-171)||(7741954-7742037)
chr4 (95-170)||(31588722-31588797)
chr4 (94-172)||(6032641-6032719)
chr4 (51-143)||(1446817-1446910)
chr4 (54-170)||(14858705-14858821)
chr4 (77-170)||(17080061-17080154)
chr4 (51-169)||(295534-295652)
chr4 (76-170)||(3574448-3574540)
chr4 (86-169)||(21429328-21429411)
chr4 (84-170)||(21192665-21192751)
chr4 (109-170)||(2686455-2686516)
chr4 (86-170)||(6862251-6862334)
chr4 (70-170)||(24166461-24166561)
chr4 (130-170)||(25406563-25406603)
chr4 (87-171)||(48352508-48352592)
chr4 (59-170)||(48834700-48834811)
chr4 (58-160)||(3507269-3507371)
chr4 (47-170)||(20421761-20421884)
chr4 (86-161)||(40272340-40272415)
chr4 (51-137)||(41339428-41339515)
chr4 (72-170)||(18531532-18531630)
chr4 (81-170)||(16645140-16645229)
chr4 (51-170)||(27248419-27248537)
chr4 (70-170)||(10541027-10541126)
chr4 (130-170)||(33176085-33176125)
[»] chr8 (36 HSPs)
chr8 (51-170)||(10927596-10927716)
chr8 (51-171)||(4479295-4479415)
chr8 (51-170)||(6100462-6100582)
chr8 (51-171)||(15884555-15884675)
chr8 (75-170)||(43032916-43033011)
chr8 (51-146)||(1013001-1013097)
chr8 (51-170)||(2467118-2467238)
chr8 (94-170)||(10535404-10535480)
chr8 (52-170)||(2964067-2964186)
chr8 (52-170)||(24837233-24837352)
chr8 (54-170)||(17981434-17981551)
chr8 (54-170)||(45521162-45521278)
chr8 (51-166)||(44893282-44893398)
chr8 (70-166)||(68102-68198)
chr8 (70-170)||(8141112-8141212)
chr8 (86-170)||(8997544-8997628)
chr8 (51-170)||(14846566-14846685)
chr8 (70-170)||(43027315-43027415)
chr8 (51-127)||(38922457-38922534)
chr8 (86-170)||(11298267-11298351)
chr8 (51-170)||(14666071-14666191)
chr8 (70-170)||(16893947-16894045)
chr8 (56-137)||(6042816-6042898)
chr8 (76-162)||(26570940-26571026)
chr8 (81-170)||(16291203-16291292)
chr8 (82-170)||(3418513-3418601)
chr8 (54-170)||(17845726-17845840)
chr8 (58-158)||(29933770-29933870)
chr8 (86-161)||(3567930-3568005)
chr8 (86-149)||(22958796-22958859)
chr8 (87-170)||(23895595-23895678)
chr8 (116-170)||(3692889-3692943)
chr8 (81-171)||(13357955-13358045)
chr8 (116-170)||(22212515-22212569)
chr8 (130-167)||(4772054-4772091)
chr8 (70-162)||(9860003-9860095)
[»] chr3 (61 HSPs)
chr3 (51-170)||(54261212-54261332)
chr3 (70-171)||(3507533-3507634)
chr3 (51-170)||(15320172-15320292)
chr3 (51-170)||(31072864-31072984)
chr3 (51-170)||(45877440-45877560)
chr3 (70-170)||(47471838-47471937)
chr3 (42-170)||(47219121-47219250)
chr3 (51-170)||(7328830-7328949)
chr3 (70-170)||(26043818-26043918)
chr3 (70-170)||(28572212-28572312)
chr3 (51-170)||(35315942-35316062)
chr3 (70-166)||(55069684-55069780)
chr3 (51-167)||(10040543-10040659)
chr3 (70-171)||(53649733-53649834)
chr3 (70-170)||(7650233-7650333)
chr3 (51-166)||(15795499-15795614)
chr3 (51-170)||(29135899-29136019)
chr3 (47-170)||(35998572-35998695)
chr3 (86-170)||(47749106-47749190)
chr3 (49-170)||(45450448-45450569)
chr3 (81-170)||(19146978-19147067)
chr3 (51-170)||(3136695-3136814)
chr3 (42-149)||(3755547-3755655)
chr3 (51-170)||(25294946-25295066)
chr3 (70-170)||(26361968-26362068)
chr3 (70-170)||(30045827-30045927)
chr3 (70-170)||(30767248-30767348)
chr3 (51-158)||(52364813-52364921)
chr3 (75-170)||(928611-928706)
chr3 (51-137)||(28242264-28242351)
chr3 (70-166)||(19873373-19873474)
chr3 (116-170)||(36043675-36043729)
chr3 (70-148)||(47303512-47303590)
chr3 (100-170)||(49021204-49021274)
chr3 (70-172)||(50405602-50405704)
chr3 (51-111)||(11687169-11687230)
chr3 (58-170)||(13893919-13894032)
chr3 (70-170)||(7310704-7310804)
chr3 (70-170)||(29127925-29128025)
chr3 (51-166)||(35923628-35923744)
chr3 (70-170)||(51060282-51060382)
chr3 (70-169)||(4638160-4638259)
chr3 (70-137)||(10855390-10855457)
chr3 (95-170)||(29762156-29762231)
chr3 (95-170)||(54237479-54237554)
chr3 (116-170)||(22909835-22909889)
chr3 (88-166)||(24506653-24506731)
chr3 (58-171)||(49198344-49198458)
chr3 (86-159)||(8164575-8164648)
chr3 (102-170)||(10043720-10043788)
chr3 (75-171)||(40660327-40660423)
chr3 (86-170)||(49543541-49543625)
chr3 (54-168)||(26207804-26207919)
chr3 (95-170)||(43330733-43330808)
chr3 (54-160)||(45402362-45402469)
chr3 (81-171)||(34662319-34662409)
chr3 (116-166)||(44064596-44064646)
chr3 (116-170)||(47164158-47164212)
chr3 (116-166)||(50753346-50753396)
chr3 (70-171)||(6462418-6462519)
chr3 (96-169)||(8362609-8362682)
[»] chr7 (47 HSPs)
chr7 (70-170)||(21530757-21530857)
chr7 (51-170)||(38578867-38578987)
chr7 (70-171)||(26423287-26423387)
chr7 (51-170)||(1605930-1606050)
chr7 (51-166)||(13095847-13095963)
chr7 (51-170)||(14650306-14650426)
chr7 (51-170)||(22993367-22993487)
chr7 (51-170)||(47341865-47341985)
chr7 (42-170)||(43861972-43862101)
chr7 (51-170)||(10047876-10047996)
chr7 (70-170)||(17748382-17748482)
chr7 (94-170)||(41945506-41945582)
chr7 (51-170)||(48804672-48804792)
chr7 (51-169)||(18785658-18785777)
chr7 (49-171)||(27875087-27875210)
chr7 (54-170)||(34659218-34659335)
chr7 (51-170)||(5069815-5069935)
chr7 (86-170)||(8734686-8734770)
chr7 (51-166)||(16802112-16802228)
chr7 (70-170)||(27028288-27028388)
chr7 (51-162)||(42032085-42032197)
chr7 (63-171)||(5039417-5039526)
chr7 (77-170)||(28744178-28744271)
chr7 (70-166)||(1797469-1797565)
chr7 (51-170)||(22973956-22974076)
chr7 (86-170)||(37514946-37515030)
chr7 (54-166)||(39420830-39420942)
chr7 (96-170)||(3353459-3353533)
chr7 (101-170)||(3603397-3603466)
chr7 (51-170)||(4195202-4195322)
chr7 (51-166)||(23658168-23658284)
chr7 (86-170)||(29805440-29805524)
chr7 (70-170)||(49142669-49142769)
chr7 (107-170)||(32768983-32769046)
chr7 (51-147)||(43925501-43925598)
chr7 (76-164)||(28396166-28396254)
chr7 (63-166)||(45960007-45960111)
chr7 (86-170)||(48244356-48244440)
chr7 (52-170)||(10317746-10317864)
chr7 (87-170)||(48551883-48551966)
chr7 (64-170)||(32823246-32823352)
chr7 (96-170)||(42210262-42210336)
chr7 (58-170)||(21190780-21190893)
chr7 (117-170)||(34127645-34127698)
chr7 (95-168)||(38988934-38989006)
chr7 (130-170)||(22268041-22268081)
chr7 (70-170)||(29151949-29152049)
[»] scaffold0291 (1 HSPs)
scaffold0291 (56-170)||(6849-6964)
[»] chr1 (52 HSPs)
chr1 (70-170)||(5855529-5855629)
chr1 (51-170)||(8763978-8764098)
chr1 (70-170)||(17642005-17642105)
chr1 (51-170)||(18915854-18915974)
chr1 (51-170)||(45361883-45362003)
chr1 (47-161)||(33418125-33418240)
chr1 (82-170)||(10422807-10422895)
chr1 (51-170)||(43959822-43959942)
chr1 (51-170)||(49078101-49078221)
chr1 (51-170)||(41663857-41663977)
chr1 (95-170)||(4581683-4581758)
chr1 (54-170)||(37339809-37339927)
chr1 (70-159)||(12036756-12036845)
chr1 (81-170)||(32142847-32142936)
chr1 (51-170)||(9659180-9659299)
chr1 (51-170)||(16956453-16956573)
chr1 (70-170)||(26325819-26325919)
chr1 (70-170)||(35211173-35211273)
chr1 (51-170)||(45726434-45726554)
chr1 (75-138)||(32883-32946)
chr1 (87-170)||(10172972-10173055)
chr1 (70-162)||(15465972-15466064)
chr1 (70-170)||(16263552-16263652)
chr1 (70-170)||(21849206-21849305)
chr1 (51-170)||(33004016-33004136)
chr1 (54-127)||(6563431-6563505)
chr1 (54-147)||(33498863-33498957)
chr1 (58-170)||(11397890-11398002)
chr1 (102-170)||(5504070-5504138)
chr1 (81-161)||(14254278-14254358)
chr1 (47-166)||(26258679-26258798)
chr1 (70-170)||(32150923-32151023)
chr1 (94-170)||(34719807-34719883)
chr1 (70-170)||(50503362-50503462)
chr1 (81-170)||(12744524-12744613)
chr1 (81-170)||(12755514-12755603)
chr1 (81-170)||(50371835-50371924)
chr1 (70-170)||(2980932-2981032)
chr1 (70-170)||(15238107-15238207)
chr1 (86-166)||(30927732-30927812)
chr1 (51-122)||(45536695-45536767)
chr1 (118-170)||(51437512-51437564)
chr1 (84-159)||(48761197-48761272)
chr1 (88-170)||(2567301-2567383)
chr1 (79-161)||(10507714-10507796)
chr1 (100-170)||(14357792-14357862)
chr1 (96-170)||(19195399-19195468)
chr1 (116-170)||(26660191-26660244)
chr1 (102-170)||(6899597-6899665)
chr1 (116-168)||(17092480-17092532)
chr1 (70-166)||(31576552-31576648)
chr1 (70-170)||(44969672-44969771)
[»] scaffold0010 (1 HSPs)
scaffold0010 (75-170)||(155711-155806)
[»] scaffold0016 (1 HSPs)
scaffold0016 (70-170)||(8701-8801)
[»] scaffold0170 (1 HSPs)
scaffold0170 (63-161)||(9846-9945)
[»] scaffold0376 (1 HSPs)
scaffold0376 (51-170)||(12659-12779)
[»] scaffold0086 (1 HSPs)
scaffold0086 (70-170)||(26192-26292)
[»] scaffold0009 (2 HSPs)
scaffold0009 (70-170)||(42832-42932)
scaffold0009 (116-173)||(9497-9554)
[»] scaffold0002 (2 HSPs)
scaffold0002 (51-170)||(319411-319531)
scaffold0002 (51-170)||(559-679)
[»] scaffold0011 (2 HSPs)
scaffold0011 (91-170)||(186547-186626)
scaffold0011 (101-170)||(224357-224426)
[»] scaffold0005 (2 HSPs)
scaffold0005 (51-137)||(271107-271194)
scaffold0005 (96-170)||(250025-250099)
[»] scaffold0384 (1 HSPs)
scaffold0384 (53-162)||(5964-6073)
[»] scaffold0316 (1 HSPs)
scaffold0316 (70-170)||(1614-1714)
[»] scaffold0006 (1 HSPs)
scaffold0006 (70-168)||(68526-68621)
[»] scaffold0004 (1 HSPs)
scaffold0004 (51-170)||(7835-7955)
[»] scaffold0341 (1 HSPs)
scaffold0341 (54-127)||(18624-18698)
[»] scaffold0223 (1 HSPs)
scaffold0223 (88-170)||(16906-16988)
[»] scaffold0029 (1 HSPs)
scaffold0029 (86-170)||(41069-41153)
[»] scaffold0001 (1 HSPs)
scaffold0001 (86-170)||(65152-65236)
[»] scaffold0079 (1 HSPs)
scaffold0079 (130-170)||(8232-8272)


Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 51)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 42291658 - 42291434
Alignment:
18 gagcctcctatttcatagggacgactttgcaaagacgtacccggagaataccgg-tttgattcccaggaggaacaatgcttggccagtgcacatgtctat 116  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||  |||||| |||||||||||||||||| || |    
42291658 gagcctcctatttcatagggacgaccttgcaaagacgtacccggagaataccgggtttgattcccagggtgaacaacgcttggccagtgcacatgcctct 42291559  T
117 acgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaaagcc-nnnnnnnntaactgcaactaggatagtgagtgaaatcccat 215  Q
    |||||||||||| ||||||||| |||||||| ||  ||||||||||||||||||||||         |||||||||||||||||||||||||||||||||    
42291558 acgcacgagccggattagtcgtccacctttgatggatcggaaaccggtgcgaaaagccaaaaataaataactgcaactaggatagtgagtgaaatcccat 42291459  T
216 cattttgtatatcaggtttgcactt 240  Q
    |||||||||||||||||||||||||    
42291458 cattttgtatatcaggtttgcactt 42291434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 8513506 - 8513626
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||||| ||| | |||||||||||||||||||||||| || ||||||||||||  ||||||||| ||||||||||    
8513506 gacgtacccggggaataccgggttcgattcctaggggaaacaatgcttggccagtgcacatgcctctacgcacgagccagattagtcgtccacctttggt 8513605  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
8513606 gggtcggaaaccggtgcgaaa 8513626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 5732040 - 5731920
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||||||||||||||||| ||||||||||||| |||| || |||| | |||||  ||||||||||||||||| ||    
5732040 gacgtacccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgtatgagccagattagtcgttcacctttagt 5731941  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
5731940 gggtcggaaaccggtgcgaaa 5731920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 42086314 - 42086434
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||  ||||||||| || |||||||||| ||||||| ||||| ||||||| |||| || |||||| |||||| ||||||||| ||||||||||    
42086314 gacgtacccgaggaataccgggttcgattcccagggggaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggt 42086413  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
42086414 gggtcggaaaccggtgcgaaa 42086434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 62 - 170
Target Start/End: Original strand, 9805002 - 9805111
Alignment:
62 agaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaac 160  Q
    |||||||||| || |||||||||| ||||||| ||||||||||||| |||| || |||||| |||||| ||||||||| ||||||||||| |||||||||    
9805002 agaataccgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaac 9805101  T
161 cggtgcgaaa 170  Q
     |||||||||    
9805102 aggtgcgaaa 9805111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 12081915 - 12082015
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| ||||| |||| ||||||| ||||||||||||| ||||  | ||||||||||||||||||||||| |||||||||||||||||||| ||||| |||    
12081915 ggttcgattctcagggggaacaacgcttggccagtgcgcatgcatctacgcacgagccgaattagtcgtccacctttggtgagtcggaaatcggtgtgaa 12082014  T
170 a 170  Q
    |    
12082015 a 12082015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 52 - 170
Target Start/End: Complemental strand, 41163578 - 41163460
Alignment:
52 acgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtg 150  Q
    |||||||||| ||||||||| || |||||||||| ||||||| | ||||||||||||||||||| |||||| |||| | ||||||||| ||||||| |||    
41163578 acgtacccggggaataccgggttcgattcccagg-ggaacaacgtttggccagtgcacatgtctctacgcatgagctggattagtcgtccaccttttgtg 41163480  T
151 agtcggaaaccggtgcgaaa 170  Q
     ||||||||| |||||||||    
41163479 ggtcggaaactggtgcgaaa 41163460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 19572711 - 19572831
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || |||||||||| |||||||  |||||||||||| |||| || |||||| |||||| |||||||||||||| |||||    
19572711 gacgtatccggggaataccgggttagattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccattggt 19572810  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | || ||||||| ||||||||    
19572811 gggttggaaaccagtgcgaaa 19572831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 25417303 - 25417183
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||| ||| ||||||||| || |||||||||| ||||||| ||||||||||||| |||| || |||| |||||||| ||||||| || ||| |||||    
25417303 gacgtactcggggaataccgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgaacgagccggattagtcatttaccattggt 25417204  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||| |||||||||||||||    
25417203 gggtcagaaaccggtgcgaaa 25417183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 1538438 - 1538538
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| |||||||  |||||||||||| |||| || |||||| |||||| |||| |||| |||| |||||| ||||||||||||||||||    
1538438 ggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgtccaccattggtgggtcggaaaccggtgcgaa 1538537  T
170 a 170  Q
    |    
1538538 a 1538538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 9812859 - 9812979
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||||| ||||||||||| ||||||||||||  ||||  | |||||| || ||| ||||||||  ||||||||||    
9812859 gacgtacccggggaataccgggttcgattccgaggaggaacaacgcttggccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggt 9812958  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||| |||||||||||||||    
9812959 gggtcagaaaccggtgcgaaa 9812979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 12766118 - 12766238
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||||  ||||||||||||||||||||||||  |||| || |||||| || ||  ||||||||  ||||||||||    
12766118 gacgtacccggggaataccgggttcgattctgaggaggaacaatgcttggccagtgtgcatgcctctacgcatgaaccagattagtcgcccacctttggt 12766217  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||| |||||||||||||||    
12766218 gggtcagaaaccggtgcgaaa 12766238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 23383664 - 23383764
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| ||||||| ||||||||||||| | || || |||||| |||| | ||||||||| ||||||||||| ||||||||| ||||||||    
23383664 ggttcgattcccagggggaacaacgcttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaactggtgcgaa 23383763  T
170 a 170  Q
    |    
23383764 a 23383764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 30349566 - 30349686
Alignment:
51 gacgtacccggagaataccgg-tttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| ||||||| | ||| ||||||||| ||||||||||| |||| || || ||| |||| ||||||||||| |||||| |||    
30349566 gacgtatccggggaataccgggtttgatttctagggggaacaatgattggccagtgcgcatgcctctatgcatgagctgaattagtcgtccaccttaggt 30349665  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | | |||||||||||||||||    
30349666 gggccggaaaccggtgcgaaa 30349686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 75 - 170
Target Start/End: Original strand, 40117427 - 40117522
Alignment:
75 gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| ||||| ||||||| ||||||||||||| |||| || |||||| |||||| |||| ||||||||||||||||  ||| ||||||||||||||    
40117427 gatttccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacctttggtggatcgaaaaccggtgcgaaa 40117522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 81 - 170
Target Start/End: Complemental strand, 14588706 - 14588617
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||| || ||||| ||||||| |||| || |||||| |||||| ||||||||| ||||||||||||| || ||||||||||||||    
14588706 caggaggaataacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgagccgaaaaccggtgcgaaa 14588617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 70 - 171
Target Start/End: Original strand, 20525845 - 20525946
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| |||||||  ||| |||||||| |||| || |||||| |||||| ||||||||| |||| ||||||  |||||||||||||||||    
20525845 ggttcgattcccaggtggaacaacacttcgccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtggatcggaaaccggtgcgaa 20525944  T
170 aa 171  Q
    ||    
20525945 aa 20525946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 81 - 166
Target Start/End: Complemental strand, 39099868 - 39099783
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgc 166  Q
    |||| |||||||  ||||||||||||||||| || |||||| |||||| ||||||||  ||||||||||| |||||||||||||||    
39099868 cagggggaacaacacttggccagtgcacatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgc 39099783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 7866568 - 7866688
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||  ||||||||| || |||||| ||||||||||| ||||||||||||  |||| || ||||||||| ||| ||||||||  ||||||||||    
7866568 gacgtacccgaggaataccgggttcgattccgaggaggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgcccacctttggt 7866667  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||  |||||| ||||||||    
7866668 gggttagaaaccagtgcgaaa 7866688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 12705001 - 12705121
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||||| ||||||||||| ||||| ||||||  ||||  | |||||| || ||| ||||||||  ||||||||||    
12705001 gacgtacccggggaataccgggttcgattccgaggaggaacaacgcttgaccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggt 12705100  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||| |||||||||||||||    
12705101 gggtcagaaaccggtgcgaaa 12705121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 20682717 - 20682617
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||| ||||| ||||||| ||||||||||||| |||| || ||||||||||||| |||| |||  ||||||| ||| || |||||||||||||||    
20682717 ggttagatttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattaatcgaccacctttagtgggttggaaaccggtgcgaa 20682618  T
170 a 170  Q
    |    
20682617 a 20682617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 37263228 - 37263347
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||| ||| || ||||| |||| ||||||| ||||||||| ||| |||| || ||||||||||||| ||||||||| |||||||  |    
37263228 gacgtacccggggaatatcgggttcgattctcagg-ggaacaacgcttggccaatgcgcatgcctctacgcacgagccggattagtcgtccacctttatt 37263326  T
150 gagtcggaaaccggtgcgaaa 170  Q
    |  ||||||||||||||||||    
37263327 ggatcggaaaccggtgcgaaa 37263347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 166
Target Start/End: Complemental strand, 3654041 - 3653918
Alignment:
42 ctttgcaaagacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttc 140  Q
    |||| ||| ||||||||||||||||||||| || |||||| ||   |||||| ||||| ||||||| |||| || |||||||||| || ||||||||| |    
3654041 ctttccaaggacgtacccggagaataccgggttcgattcctaga--gaacaacgcttgaccagtgcgcatgcctctacgcacgaggcggattagtcgtcc 3653944  T
141 acctttggtgagtcggaaaccggtgc 166  Q
    ||||||||||  ||| ||||||||||    
3653943 acctttggtggatcgaaaaccggtgc 3653918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 70 - 147
Target Start/End: Complemental strand, 7308464 - 7308387
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttg 147  Q
    |||| |||||||||| ||||||| |||||| ||||||||||| || |||||| |||||| |||||||| |||||||||    
7308464 ggttcgattcccagggggaacaacgcttgggcagtgcacatgcctctacgcatgagccggattagtcgctcacctttg 7308387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 81 - 170
Target Start/End: Original strand, 13664278 - 13664367
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| |||||||  |||||||||||| |||| || |||||| |||||  |||| ||| |||||||||||| |||||||||||||||||||    
13664278 cagggggaacaacacttggccagtgcgcatgcctctacgcatgagccagattaatcgatcacctttggtgtgtcggaaaccggtgcgaaa 13664367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 81 - 170
Target Start/End: Original strand, 20255387 - 20255476
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||| ||||||  |||| ||||||| |||| || |||||| ||| || ||||||||| ||||||||||||||||||||| |||||||||    
20255387 caggacgaacaacacttgaccagtgcgcatgcctctacgcatgagtcggattagtcgtccacctttggtgagtcggaaactggtgcgaaa 20255476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 81 - 170
Target Start/End: Original strand, 43399146 - 43399235
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| |||| || ||||||||||||| |||| || ||||||||||| | ||||||||| ||| ||||||  |||||||||||||||||||    
43399146 cagggggaataacgcttggccagtgcgcatgcctctacgcacgagcaggattagtcgtccacatttggttggtcggaaaccggtgcgaaa 43399235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 86 - 170
Target Start/End: Complemental strand, 38897803 - 38897719
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||| ||||||||||||| |||| || ||||||||||||| |||||| |  |||||||||||  ||||||||| ||||||||    
38897803 ggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagttgcccacctttggtggatcggaaaccagtgcgaaa 38897719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 86 - 170
Target Start/End: Original strand, 41801000 - 41801084
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||| ||||| ||| ||| ||||||| ||||||||||||| |||||||||||| ||||| || |||||||| ||||| ||||    
41801000 ggaacaacgcttgaccaatgcgcatgtctctacgcacgagccggattagtcgttcatctttgatgggtcggaaagcggtgtgaaa 41801084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 47 - 166
Target Start/End: Complemental strand, 18136404 - 18136280
Alignment:
47 caaagacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccg----aattagtcgttca 141  Q
    |||||||||| |||||||||||||| || |||||||||| |||||||  ||||| |||||  |||| || ||| || ||||||    |||||||||| ||    
18136404 caaagacgtatccggagaataccgggttcgattcccagggggaacaacacttggtcagtgtgcatgcctctacacatgagccggattaattagtcgtcca 18136305  T
142 cctttggtgagtcggaaaccggtgc 166  Q
    || |||||| |||||||||||||||    
18136304 ccattggtgggtcggaaaccggtgc 18136280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 70 - 169
Target Start/End: Original strand, 28862832 - 28862931
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| ||||| |||| ||||||| ||||||||| |||||||| || ||||||||| | |||||||| | ||||| || ||  ||||||||||||||||||    
28862832 ggttcgattctcaggcggaacaacgcttggccaatgcacatgcctctacgcacgacctgaattagttgctcaccattagtaggtcggaaaccggtgcgaa 28862931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 116 - 170
Target Start/End: Original strand, 28857002 - 28857056
Alignment:
116 tacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||| |||||| |||||||| |||||||||||| |||||||||||||||||||    
28857002 tacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaa 28857056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 116 - 170
Target Start/End: Original strand, 28857199 - 28857253
Alignment:
116 tacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||| |||||| |||||||| |||||||||||| |||||||||||||||||||    
28857199 tacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaa 28857253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 81 - 170
Target Start/End: Complemental strand, 4016344 - 4016255
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| |||||||  |||||||||||| |||| || ||| ||||||||| |||||| | ||||| |||||| |||||||||| ||||||||    
4016344 cagggggaacaacacttggccagtgcgcatgcctctacacacgagccggattagttgctcaccattggtgggtcggaaaccagtgcgaaa 4016255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 89 - 170
Target Start/End: Original strand, 14728109 - 14728190
Alignment:
89 acaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| |||||| |||||| |||| || |||||| |||||| |||||| | ||||||||| || |||||||||||||||||||    
14728109 acaacgcttggtcagtgcgcatgcctctacgcatgagccggattagttgctcacctttgatgggtcggaaaccggtgcgaaa 14728190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 47 - 166
Target Start/End: Complemental strand, 9168376 - 9168257
Alignment:
47 caaagacgtacccggagaataccg-gtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctt 145  Q
    |||||||||| |||| |||||||| |   ||||||||| |||||||| ||||||||||||| |||  || |||||| |||||| ||||||||| ||||||    
9168376 caaagacgtatccggggaataccgagaacgattcccag-aggaacaacgcttggccagtgcgcatacctctacgcatgagccggattagtcgtccacctt 9168278  T
146 tggtgagtcggaaaccggtgc 166  Q
    | ||| |||| ||| ||||||    
9168277 tagtgggtcgaaaatcggtgc 9168257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 20692920 - 20693040
Alignment:
51 gacgtacccggagaataccgg-tttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| ||||||||| ||  | ||||| ||||||||||| |||||| || |  ||| ||  |  |||||| || ||||||||||    
20692920 gacgtacccggggaataccgggtttgattcctagaggaaacaacgcttggccagtacacatgcctctgtgcatgattcagattagttgtccacctttggt 20693019  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
20693020 gggtcggaaaccggtgcgaaa 20693040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 23247451 - 23247352
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||||||||||| |||||  ||||   |||| || ||||||||||||  ||||||||| |||||||| || |||| |||||||||||||    
23247451 ggttcgattcccaggaggaacaacgcttgatcagtatgcatgcctctacgcacgagccagattagtcgtccacctttgatg-gtcgaaaaccggtgcgaa 23247353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 70 - 150
Target Start/End: Original strand, 30995128 - 30995208
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtg 150  Q
    |||| |||||||||| |||||||  ||||||||| || |||| || ||||||||||||| |||||||| ||| ||||||||    
30995128 ggttcgattcccagggggaacaacacttggccagggcgcatgcctctacgcacgagccggattagtcgctcatctttggtg 30995208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 95 - 170
Target Start/End: Complemental strand, 42861293 - 42861218
Alignment:
95 cttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||||| |||| || |||||| |||||| |||| |||| |||| |||||| |||||| ||||||||||||    
42861293 cttggccagtgcgcatgcctctacgcatgagccggattaatcgtccaccattggtgggtcggagaccggtgcgaaa 42861218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 54 - 166
Target Start/End: Original strand, 1898991 - 1899098
Alignment:
54 gtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgag 152  Q
    |||||||| ||||||||| || |||||||||| ||||||| ||||||||||||| ||||      |||||||||||||||||||   ||||||| ||| |    
1898991 gtacccggggaataccgggttcgattcccagggggaacaacgcttggccagtgcgcatg------cgcacgagccgaattagtcacccaccttttgtggg 1899084  T
153 tcggaaaccggtgc 166  Q
    |  |||||||||||    
1899085 ttagaaaccggtgc 1899098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 96 - 150
Target Start/End: Complemental strand, 14974398 - 14974344
Alignment:
96 ttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtg 150  Q
    |||||||||||||||| || |||||| |||||| ||||||||| |||||||||||    
14974398 ttggccagtgcacatgcctctacgcatgagccggattagtcgtccacctttggtg 14974344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 73 - 170
Target Start/End: Original strand, 5079341 - 5079437
Alignment:
73 ttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||| ||||| ||||||  |||||| || ||| ||||  | ||||||||||||| ||||||||  ||||||||||| |||| ||||||||||||||    
5079341 ttgatttccagggggaacagcgcttggtcaatgcgcatgcttctacgcacgagccggattagtcgcccacctttggtg-gtcgaaaaccggtgcgaaa 5079437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 70 - 127
Target Start/End: Original strand, 26077148 - 26077205
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagcc 127  Q
    |||| |||||||||  ||||||| |||||||||||||||||| || ||||||||||||    
26077148 ggttcgattcccagagggaacaacgcttggccagtgcacatgcctctacgcacgagcc 26077205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 121 - 170
Target Start/End: Original strand, 40773331 - 40773380
Alignment:
121 acgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||| || |||||||||||| |||||||| |||||||||||||||||||    
40773331 acgagtcggattagtcgttcatctttggtgcgtcggaaaccggtgcgaaa 40773380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 87 - 159
Target Start/End: Original strand, 24875369 - 24875441
Alignment:
87 gaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaa 159  Q
    |||||| | ||| ||||||| ||||||| ||||||||||||| |||| |||| |||||||| || ||||||||    
24875369 gaacaacgtttgaccagtgcgcatgtctctacgcacgagccggattaatcgtccacctttgatgggtcggaaa 24875441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 95 - 166
Target Start/End: Original strand, 39728419 - 39728490
Alignment:
95 cttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgc 166  Q
    |||||||||||  |||| || ||||| |||| ||||||||||| ||||||||| |  |||||||||||||||    
39728419 cttggccagtgtgcatgcctctacgctcgagtcgaattagtcgctcacctttgatacgtcggaaaccggtgc 39728490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 128
Target Start/End: Original strand, 28857115 - 28857193
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccg 128  Q
    |||| |||||| ||||||||| || |||||||||| |||||||  |||||||||||| |||| || |||||| ||||||    
28857115 gacgcacccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccg 28857193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 86 - 160
Target Start/End: Original strand, 32874810 - 32874884
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaac 160  Q
    ||||||| ||||| | ||||| |||  || |||||||||||||||||| |||| |||| |||||| |||||||||    
32874810 ggaacaacgcttgactagtgcgcatacctttacgcacgagccgaattaatcgtccaccattggtgggtcggaaac 32874884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 86 - 167
Target Start/End: Original strand, 20590022 - 20590103
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcg 167  Q
    ||||||| ||||||||||||| |||| || |||||| |||||| |||||| || |||  |||| |  |||||||||||||||    
20590022 ggaacaacgcttggccagtgcgcatgactctacgcatgagccgtattagttgtccactattggaggatcggaaaccggtgcg 20590103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 86 - 170
Target Start/End: Complemental strand, 11845885 - 11845801
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||| | ||||||||||| |||| || |||| | ||||||||||| |||  |||||||| || || ||||||||||| ||||    
11845885 ggaacaacgtttggccagtgcgcatgcctctacgtatgagccgaattaatcgcccacctttgatgggttggaaaccggtgtgaaa 11845801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 77; Significance: 7e-36; HSPs: 56)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 41220621 - 41220741
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||||||||||||||||| ||||||||||||| |||| || |||||| |||||||||||||||||||||||| ||    
41220621 gacgtacccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccgaattagtcgttcacctttagt 41220720  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
41220721 gggtcggaaaccggtgcgaaa 41220741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 10823046 - 10823166
Alignment:
51 gacgtacccggagaataccgg-tttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| ||||||||||||||||||||| ||||||||||||| |||| || ||||||||||||| ||||||||  ||||||| ||    
10823046 gacgtacccggggaataccgggtttgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccaccttttgt 10823145  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
10823146 gggtcggaaaccggtgcgaaa 10823166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 70 - 166
Target Start/End: Original strand, 10669598 - 10669694
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgc 166  Q
    |||||||||||||||  |||||| ||||||||||||| ||||||| |||||||||| || |||| |||||||||||||||| |||||||||||||||    
10669598 ggtttgattcccagggagaacaacgcttggccagtgcgcatgtctctacgcacgagtcggattaatcgttcacctttggtgggtcggaaaccggtgc 10669694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 25540504 - 25540404
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||| ||| ||||||| ||||||||||||| |||| || ||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||    
25540504 ggttcgattcctagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaa 25540405  T
170 a 170  Q
    |    
25540404 a 25540404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 7747260 - 7747380
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || |||||| ||||||||||| | ||||||||||  |||| || |||||| |||||| ||||||||||||||||| ||    
7747260 gacgtatccggggaataccgggttcgattcctaggaggaacaacgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacctttagt 7747359  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
7747360 gggtcggaaaccggtgcgaaa 7747380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 8410117 - 8410237
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||||||||| ||| || |||||||||| |||||||  |||||||||||| |||| || ||||||||||||| ||||||||  ||| |||||     
8410117 gacgtacccggagaatatcgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacttttggg 8410216  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
8410217 gggtcggaaaccggtgcgaaa 8410237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 11069864 - 11069984
Alignment:
51 gacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||| |||| |||||| ||| ||||||| | ||||||||||| |||  || ||||||||||| ||||||||||| |||| |||||    
11069864 gacgtacccggggaataccaggttcgattccgagggggaacaacgtttggccagtgcgcatacctctacgcacgagctgaattagtcgtccaccgttggt 11069963  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||||||||||| |||||||    
11069964 gggtcggaaaccgatgcgaaa 11069984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 55 - 170
Target Start/End: Original strand, 12455300 - 12455416
Alignment:
55 tacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagt 153  Q
    ||||||| ||||||||| || |||| ||||| | ||||| |||| |||||||| |||| || ||||||||||||| |||||||| ||||| |||||| ||    
12455300 tacccggggaataccgggttcgatttccaggggaaacaacgcttagccagtgcgcatgcctctacgcacgagccggattagtcgctcaccattggtgggt 12455399  T
154 cggaaaccggtgcgaaa 170  Q
    |||||||||||||||||    
12455400 cggaaaccggtgcgaaa 12455416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 18902650 - 18902530
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||| ||| ||||||||| || |||||||| | ||||||| ||||| ||||||| | ||||| ||||||||||||  ||||||||  ||||||||||    
18902650 gacgtactcggggaataccgggttcgattcccacggggaacaacgcttgaccagtgcgcgtgtctctacgcacgagccagattagtcgcccacctttggt 18902551  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
18902550 gggtcggaaaccggtgcgaaa 18902530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 71 - 170
Target Start/End: Original strand, 27725947 - 27726046
Alignment:
71 gtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||| |||||||||||||||||||||||||| |||| || ||||||| ||||| ||||||||  ||||  ||||| |||||||||||||| ||||    
27725947 gtttgattctcaggaggaacaatgcttggccagtgcgcatgcctctacgcactagccggattagtcgcccaccaatggtgggtcggaaaccggtgtgaaa 27726046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 75 - 165
Target Start/End: Complemental strand, 39201603 - 39201513
Alignment:
75 gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtg 165  Q
    ||||| |||| ||||||||| ||||||||||  |||| || |||||| |||||| ||||||||||||||||||||| ||||||||||||||    
39201603 gattctcagggggaacaatgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacctttggtgggtcggaaaccggtg 39201513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 3644007 - 3643887
Alignment:
51 gacgtacccggagaataccgg-tttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| ||||||| | | ||||||||| ||||||||||||| |||| || |||||| |||| | ||||||||| ||||||||||    
3644007 gacgtatccggggaataccgggtttgatttctacgaggaacaacgcttggccagtgcgcatgcctctacgcatgagctggattagtcgtccacctttggt 3643908  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | | ||||||||| |||||||    
3643907 gggccggaaaccgttgcgaaa 3643887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 22593121 - 22593239
Alignment:
51 gacgtacccggagaataccg-gtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| |||||| | ||| |||||||||| ||||||| | ||||||||||| |||| || |||||| |||||| ||||||||| ||||||||||    
22593121 gacgtacccggggaatactgagttcgattcccagggggaacaacg-ttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggt 22593219  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||||| |||||||||||||    
22593220 gggtcgg-aaccggtgcgaaa 22593239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 38962749 - 38962869
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || ||||  |||||||||||| ||||||||||||| |||| || |||||| || ||| ||||||||| ||||||||||    
38962749 gacgtatccggggaataccgggttcgattttcaggaggaacaacgcttggccagtgcgcatgcctctacgcatgaaccggattagtcgtccacctttggt 38962848  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||| ||||| |||||||||    
38962849 gggtcagaaactggtgcgaaa 38962869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 44139490 - 44139590
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| ||||||| ||||||||||||| | || || ||||||||||||| ||||||||  ||||  ||||| ||||||||||||||||||    
44139490 ggttcgattcccagggggaacaacgcttggccagtgcgcgtgcctctacgcacgagccggattagtcgcccaccaatggtgggtcggaaaccggtgcgaa 44139589  T
170 a 170  Q
    |    
44139590 a 44139590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 44945580 - 44945699
Alignment:
51 gacgtacccggagaataccgg-tttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||| |||||||||| || |||||||||||| |||||||| ||||||  ||||| |||| || ||||||||||||| ||||||||  ||||||| ||    
44945580 gacgtactcggagaatactgggtttgattcccag-aggaacaacgcttggatagtgcgcatgcctctacgcacgagccggattagtcgcccacctttagt 44945678  T
150 gagtcggaaaccggtgcgaaa 170  Q
    |  ||||||||||||||||||    
44945679 ggatcggaaaccggtgcgaaa 44945699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 51 - 171
Target Start/End: Original strand, 7787042 - 7787163
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||| ||||| |||||||| |||||||||| | |||| || ||||||||||||| ||||||||  || |||||||    
7787042 gacgtacccggggaataccgggttcgatttccagggggaacaatacttggccagtacgcatgcctctacgcacgagccggattagtcgcccatctttggt 7787141  T
150 gagtcggaaaccggtgcgaaaa 171  Q
    |  ||| |||||||||| ||||    
7787142 ggatcgaaaaccggtgcaaaaa 7787163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 81 - 170
Target Start/End: Original strand, 16034954 - 16035043
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| ||||||| ||||| ||||||  |||| ||||||| |||||||| |||||||| ||||| ||| ||||||||||||||||||||||    
16034954 caggcggaacaacgcttgaccagtgtgcatgcctatacgtacgagccggattagtcgctcaccattgatgagtcggaaaccggtgcgaaa 16035043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 42 - 161
Target Start/End: Original strand, 331478 - 331598
Alignment:
42 ctttgcaaagacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttc 140  Q
    |||| ||| ||||||||||| ||||||||| || |||||||||| |||||||  |||||||||||| ||||  | |||||| |||||| ||||||||  |    
331478 ctttccaaggacgtacccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcttctacgcatgagccggattagtcgccc 331577  T
141 acctttggtgagtcggaaacc 161  Q
    |||||||||| || |||||||    
331578 acctttggtgggttggaaacc 331598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 2550874 - 2550974
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| ||||||||||||||||||  ||| |||||||| ||||||| |||||| |||||| ||||||||  ||| ||||||| || | |||||||||||||    
2550874 ggttcgattcccaggaggaacaacacttagccagtgcgcatgtctctacgcatgagccggattagtcgcccacttttggtgggttgaaaaccggtgcgaa 2550973  T
170 a 170  Q
    |    
2550974 a 2550974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 9360868 - 9360748
Alignment:
51 gacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||| |||| |||| | ||  | ||||| | ||||||||||| |||| || ||||||||||||||||||||||  ||||||| ||    
9360868 gacgtacccggggaataccaggttcgattactagaggaaacaacgtttggccagtgcgcatgcctctacgcacgagccgaattagtcgcccacctttagt 9360769  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | | |||||||||||||||||    
9360768 gggccggaaaccggtgcgaaa 9360748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 34722686 - 34722786
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| ||||| ||||  |||||| |||||| |||||||||||||| ||||||||||||| ||||||||  |||||||| ||  || ||||||||||||||    
34722686 ggttcgattctcagggagaacaacgcttggtcagtgcacatgtctctacgcacgagccggattagtcgcccacctttgatggatcagaaaccggtgcgaa 34722785  T
170 a 170  Q
    |    
34722786 a 34722786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 35946725 - 35946844
Alignment:
51 gacgtacccggagaataccg-gtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| |||||||| ||| |||||| ||| ||||||| ||||||||| ||  |||| || ||||||||||||| ||||||||| |||| |||||    
35946725 gacgtatccggggaataccgagttcgattcctagg-ggaacaacgcttggccattgtgcatgcctctacgcacgagccggattagtcgtccaccattggt 35946823  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||||||||| |||||||||    
35946824 gggtcggaaactggtgcgaaa 35946844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 38005388 - 38005508
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| |||||| || || |||||||| | ||||||| ||||||||||||| |||| || ||| || |||||| ||||||||  ||||||||||    
38005388 gacgtacccggggaatactgggttcgattcccaaggggaacaacgcttggccagtgcgcatgcctctacacatgagccggattagtcgcccacctttggt 38005487  T
150 gagtcggaaaccggtgcgaaa 170  Q
    |  |||||||| |||||||||    
38005488 ggatcggaaactggtgcgaaa 38005508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 41032006 - 41031906
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| |||||||  |||||||||||  |||| || ||||||||||||| |||||||   ||||||||||| |||||||||| |||||||    
41032006 ggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcacccacctttggtgggtcggaaaccagtgcgaa 41031907  T
170 a 170  Q
    |    
41031906 a 41031906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 75 - 170
Target Start/End: Original strand, 16325606 - 16325701
Alignment:
75 gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||| |||||||  |||||||||||  |||| || |||||| |||||  ||||||||| |||| |||||| |||||||||||||||||||    
16325606 gattcccagggggaacaacacttggccagtgtgcatgcctctacgcatgagccagattagtcgtccaccattggtgggtcggaaaccggtgcgaaa 16325701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 51 - 160
Target Start/End: Complemental strand, 10026736 - 10026626
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||| |||| |||||||| || ||||| |||| ||||||| | ||||||||||| |||| || |||||| |||||| ||||||||  ||||||||||    
10026736 gacgtactcggaaaataccgggttcgattctcagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtcgaccacctttggt 10026637  T
150 gagtcggaaac 160  Q
    | |||||||||    
10026636 gggtcggaaac 10026626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 6358271 - 6358151
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||| | || |||| ||||| |||||||  |||||||||||| |||| || |||||| |||||| ||||||||| |||| |||||    
6358271 gacgtatccggggaataccagattcgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggt 6358172  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||| ||||||||| ||||    
6358171 gggtcgaaaaccggtgtgaaa 6358151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 86 - 170
Target Start/End: Complemental strand, 14169693 - 14169609
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||  |||| ||||||| ||||||| |||||| |||||| |||||||||  ||| |||||| |||||||||||||||||||    
14169693 ggaacaacacttgaccagtgcgcatgtctctacgcatgagccggattagtcgtctaccattggtgggtcggaaaccggtgcgaaa 14169609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 82 - 170
Target Start/End: Complemental strand, 20116700 - 20116612
Alignment:
82 aggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||||| || |||||| ||| |||| || |||||| |||||| ||||| ||| |||||||| || |||||||||||||||||||    
20116700 aggaggaacaacgcatggccaatgcgcatgcctctacgcatgagccggattagccgtccacctttgatgggtcggaaaccggtgcgaaa 20116612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 39807005 - 39806885
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||||||| ||| ||||| | ||||||||||| |||| || ||| |||||| || ||||||| | ||||||||||    
39807005 gacgtacccggggaataccgggttcgattcccaagagaaacaacgtttggccagtgcgcatgcctctacacacgagtcggattagtcatccacctttggt 39806906  T
150 gagtcggaaaccggtgcgaaa 170  Q
    |  ||  ||||||||||||||    
39806905 ggttcataaaccggtgcgaaa 39806885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 137
Target Start/End: Complemental strand, 21180434 - 21180347
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcg 137  Q
    |||||||||| |||||||||| || |||||||| |  ||||||  ||||||||||||||||| || ||||||||||||| ||||||||    
21180434 gacgtacccgaagaataccggattcgattcccatggagaacaacacttggccagtgcacatgcctctacgcacgagccggattagtcg 21180347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 63 - 150
Target Start/End: Original strand, 24179568 - 24179654
Alignment:
63 gaataccggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtg 150  Q
    ||||||||||| ||||| |||| ||||||| | |||||||||||||||| || |||||| |||||| ||||||||| || ||||||||    
24179568 gaataccggttcgattctcagg-ggaacaacgtttggccagtgcacatgcctctacgcatgagccggattagtcgtccatctttggtg 24179654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 76 - 162
Target Start/End: Complemental strand, 42770745 - 42770659
Alignment:
76 attcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccg 162  Q
    |||| |||| ||||||| ||||||||||||| |||| || | ||||||||||| |||| |||| ||||||||||| |||| ||||||    
42770745 attctcagggggaacaacgcttggccagtgcgcatgcctcttcgcacgagccggattaatcgtccacctttggtgggtcgaaaaccg 42770659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 58 - 155
Target Start/End: Complemental strand, 45263780 - 45263682
Alignment:
58 ccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcg 155  Q
    |||| ||||||||| || |||||||||  ||||||| ||||||||||||| |||| || ||||||||||||| |||| ||| ||| |||||||| ||||    
45263780 ccggggaataccgggttcgattcccagagggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattaatcgctcatctttggtgggtcg 45263682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 2528441 - 2528341
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| ||||||| |||||| |||||  |||| || ||| ||  ||||| |||||||| ||| |||| ||||||||||||| ||||||||    
2528441 ggttcgattcccagggggaacaacgcttggtcagtgtgcatgcctctacacataagccggattagtcgctcatctttagtgagtcggaaactggtgcgaa 2528342  T
170 a 170  Q
    |    
2528341 a 2528341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 3849034 - 3848914
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| | |||||||||||| || ||||  |||| | ||||| | |||||||| || ||||||| |||||||||| || |||||||||||||||||| |    
3849034 gacgtatctggagaataccgggttcgattatcaggggaaacaacgtttggccagggcgcatgtctctacgcacgagtcggattagtcgttcacctttgat 3848935  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||| |||  |||||||||    
3848934 gggtcgaaaattggtgcgaaa 3848914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 63 - 170
Target Start/End: Original strand, 12864222 - 12864330
Alignment:
63 gaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaacc 161  Q
    ||||||||| || |||| ||||| |||||||  ||||| |||||| |||| || | |||| |||||  ||||||||| |||| |||||| ||||||||||    
12864222 gaataccggattcgatttccagggggaacaacacttggtcagtgcgcatgcctctgcgcatgagccagattagtcgtccaccattggtgggtcggaaacc 12864321  T
162 ggtgcgaaa 170  Q
    |||||||||    
12864322 ggtgcgaaa 12864330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 63 - 170
Target Start/End: Complemental strand, 18649134 - 18649026
Alignment:
63 gaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaacc 161  Q
    ||||||||| || ||||| |||||||||||||  |||| |||||| |||| || |||||| ||| || |||||||| |||| ||||||| || |||||||    
18649134 gaataccggattcgattctcaggaggaacaatatttgggcagtgcgcatgcctctacgcatgagtcggattagtcgctcacttttggtgggttggaaacc 18649035  T
162 ggtgcgaaa 170  Q
    | |||||||    
18649034 gttgcgaaa 18649026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 51 - 166
Target Start/End: Original strand, 21286430 - 21286546
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || |||||||||| | ||||| ||||| ||||||| |||| || ||||||||||| | |||||||  ||| | |||||    
21286430 gacgtatccggggaataccgggttcgattcccaggcgaaacaacgcttgaccagtgcgcatgcctctacgcacgagctggattagtcactcatcattggt 21286529  T
150 gagtcggaaaccggtgc 166  Q
    | || ||||||||||||    
21286530 gggttggaaaccggtgc 21286546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 34346387 - 34346287
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||||||||  |||| |||||||  |||||||||||  |||| || |||||| ||| |  |||| ||| |||||||||||| ||||||||||||||||||    
34346387 ggtttgattatcagggggaacaacacttggccagtgtgcatgcctctacgcatgagtcagattaatcgctcacctttggtgggtcggaaaccggtgcgaa 34346288  T
170 a 170  Q
    |    
34346287 a 34346287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 37560159 - 37560279
Alignment:
51 gacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||  ||||||| |||| ||||| || | ||||||| | |||| |||||| |||| || ||||||||||||| |||| |||| |||||||| |    
37560159 gacgtacccgaggaataccaggttcgattctcaaggggaacaacgtttggtcagtgcgcatgcctctacgcacgagccggattaatcgtccacctttgat 37560258  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||| ||||||||| ||||    
37560259 gggtcgaaaaccggtgtgaaa 37560279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 70 - 171
Target Start/End: Complemental strand, 20612636 - 20612533
Alignment:
70 ggtttgattcccaggagg-aacaatgcttggccagtgcacatgtctatacgcacgagccga-attagtcgttcacctttggtgagtcggaaaccggtgcg 167  Q
    |||| ||||| ||||||| |||||  |||||||||||| |||| || || ||| ||||||  ||||||||| |||| |||||| ||||||||||||||||    
20612636 ggttcgattctcaggagggaacaacacttggccagtgcgcatgcctctatgcatgagccgggattagtcgtccaccattggtgggtcggaaaccggtgcg 20612537  T
168 aaaa 171  Q
    ||||    
20612536 aaaa 20612533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 42 - 170
Target Start/End: Complemental strand, 19976936 - 19976807
Alignment:
42 ctttgcaaagacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttc 140  Q
    |||| ||| |||||| |||| ||||||||| || ||||  |||| |||| || | |||| |||||| ||||||| ||||||  || |||||||||||  |    
19976936 ctttccaaggacgtatccggggaataccgggttcgattttcagggggaataacgtttggtcagtgcgcatgtctctacgcataagtcgaattagtcgccc 19976837  T
141 acctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||| ||| ||||||| ||||||||||    
19976836 acctttgatgaatcggaaatcggtgcgaaa 19976807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 88 - 170
Target Start/End: Original strand, 29653651 - 29653728
Alignment:
88 aacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||| |||||| |||||| |||| || ||||||||||||||||||||||  |||||||||||    ||||||||||||||||    
29653651 aacaacgcttgggcagtgcgcatgcctctacgcacgagccgaattagtcg-ccacctttggtg----ggaaaccggtgcgaaa 29653728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 81 - 170
Target Start/End: Complemental strand, 31596521 - 31596432
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| ||||||||| |||||||||||||||   | |||||| |||| |||||| ||||  ||||||| ||| | ||||||||||||||||    
31596521 cagggggaacaatgtttggccagtgcacatacttctacgcatgagctgaattaatcgtctacctttgatgaattggaaaccggtgcgaaa 31596432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 5035294 - 5035394
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| ||||||||| |  ||||||||||| ||||||| ||||||| ||||||||| ||| |||| || | |||||||  || ||||||||||  ||||||    
5035294 ggttcgattcccagaaaaaacaatgcttgaccagtgcgcatgtctctacgcacgaaccggattaatcatccacctttaatgggtcggaaacccatgcgaa 5035393  T
170 a 170  Q
    |    
5035394 a 5035394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 29422201 - 29422321
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| |||||| || || |||| ||||  |||||||  |||||||| ||  |||  || ||||||||||||| ||||||||| |||||||| |    
29422201 gacgtacccggggaatactgggttcgatttccagagggaacaacacttggccaatgagcatacctttacgcacgagccggattagtcgtccacctttgat 29422300  T
150 gagtcggaaaccggtgcgaaa 170  Q
    |  ||||||| ||||||||||    
29422301 ggatcggaaatcggtgcgaaa 29422321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 81 - 136
Target Start/End: Complemental strand, 13026500 - 13026445
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtc 136  Q
    |||||||||||||| ||||||||||| |||| || |||||| |||||| |||||||    
13026500 caggaggaacaatgattggccagtgcgcatgcctctacgcatgagccggattagtc 13026445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 137
Target Start/End: Original strand, 15079469 - 15079556
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcg 137  Q
    ||||||||||| |||||| || || |||| ||||| ||||||| ||||| ||||||  |||| || |||||||||||| |||||||||    
15079469 gacgtacccggggaatacagggttcgatttccagggggaacaacgcttgaccagtgtgcatgactctacgcacgagccaaattagtcg 15079556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 95 - 170
Target Start/End: Complemental strand, 28525530 - 28525455
Alignment:
95 cttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||||| |||| || ||||||||||||| ||||||| | |||||||  || ||||||||| |||| ||||    
28525530 cttggccagtgcgcatgcctctacgcacgagccggattagtcatccacctttaatgggtcggaaactggtgtgaaa 28525455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 115 - 170
Target Start/End: Original strand, 44023346 - 44023401
Alignment:
115 atacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||| ||| |||||||||||| || |||||||| || ||||||||||||||||    
44023346 atacgcatgagtcgaattagtcgtccatctttggtgggttggaaaccggtgcgaaa 44023401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 123 - 170
Target Start/End: Original strand, 44773322 - 44773369
Alignment:
123 gagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||| |||||||| ||||||||| || |||||||||||||||||||    
44773322 gagccggattagtcgctcacctttgatgggtcggaaaccggtgcgaaa 44773369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 77 - 170
Target Start/End: Original strand, 33005765 - 33005857
Alignment:
77 ttcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||| |||||||  |||||||||||| |||| || |||||| ||| |  |||| ||| |||||||| ||| ||||||||||| |||||||    
33005765 ttcccagg-ggaacaacacttggccagtgcgcatgcctctacgcatgaggcagattaatcgctcacctttagtgggtcggaaaccgatgcgaaa 33005857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 3811791 - 3811691
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||  |||||||  ||||| || ||| |||| || |||||| |||||| |||| |||  ||||||||||| ||| ||||||| ||||||    
3811791 ggttcgattcccagagggaacaacacttggtcaatgcgcatgcctctacgcatgagccggattactcgcccacctttggtgggtcagaaaccgatgcgaa 3811692  T
170 a 170  Q
    |    
3811691 a 3811691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 15234181 - 15234061
Alignment:
51 gacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||  |||| ||||| |||| |||||||  |||| ||||||| |||| || ||||||| ||    |||||||||||| ||||| |    
15234181 gacgtacccggggaatactaggttcgattctcagggggaacaacacttgaccagtgcgcatgcctctacgcacaagttagattagtcgttcatctttgat 15234082  T
150 gagtcggaaaccggtgcgaaa 170  Q
      ||||||||||| |||||||    
15234081 aggtcggaaaccgatgcgaaa 15234061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 29)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 21898638 - 21898758
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || |||||||||||||||||| ||||||||||||| |||| || |||||| |||||| ||||||||||||||||| ||    
21898638 gacgtatccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagt 21898737  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
21898738 gggtcggaaaccggtgcgaaa 21898758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 42 - 170
Target Start/End: Original strand, 3601065 - 3601194
Alignment:
42 ctttgcaaagacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttc 140  Q
    |||| |||| |||||  ||| |||||||||||| ||||| |||| ||||||| ||||||||||||| |||| |||||| ||||||||| ||||||||| |    
3601065 ctttccaaatacgtattcggggaataccggtttcgattctcagggggaacaacgcttggccagtgcgcatgcctatacacacgagccggattagtcgtcc 3601164  T
141 acctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||| |||||||||||||||||||    
3601165 acctttggtgggtcggaaaccggtgcgaaa 3601194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 5253343 - 5253223
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||||||||| |||||||  |||||||||||| |||| || |||||| |||||| |||| |||  ||||||||||    
5253343 gacgtacccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgcccacctttggt 5253244  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
5253243 gggtcggaaaccggtgcgaaa 5253223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 19089508 - 19089608
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    ||||||||||||||| |||||||  |||||||||||  |||| || ||||||||||||| |||||||||  |||||||||| ||||||||||||||||||    
19089508 ggtttgattcccagggggaacaacacttggccagtgagcatgcctctacgcacgagccggattagtcgtctacctttggtgggtcggaaaccggtgcgaa 19089607  T
170 a 170  Q
    |    
19089608 a 19089608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 6606217 - 6606097
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || ||||| |||| |||||||  ||||||||||| ||||| || |||||| |||||| ||||||||| |||| |||||    
6606217 gacgtatccggggaataccgggttcgattctcagggggaacaacacttggccagtgtacatgcctctacgcatgagccggattagtcgtccaccattggt 6606118  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
6606117 gggtcggaaaccggtgcgaaa 6606097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 87 - 170
Target Start/End: Complemental strand, 9633708 - 9633625
Alignment:
87 gaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||| ||||||||||||| |||| || ||||||||||||| ||||||||  ||||||||||| |||||||||||||||||||    
9633708 gaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 9633625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 8938721 - 8938821
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| ||||||||||||||||||  |||| ||||||| || |  | |||||| |||||||||||||||| |||||||| || ||||||||||||||||||    
8938721 ggttcgattcccaggaggaacaacacttgaccagtgcgcaagcatctacgcatgagccgaattagtcgtccacctttgatgggtcggaaaccggtgcgaa 8938820  T
170 a 170  Q
    |    
8938821 a 8938821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 12635804 - 12635924
Alignment:
51 gacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||| ||||||||||||||| | ||||| ||||||| ||||| |||| || ||||||| ||||| ||||||||  |||  |||||    
12635804 gacgtatccggggaataccaggtttgattcccaggggaaacaacgcttggctagtgcgcatgcctctacgcacaagccggattagtcgcccactattggt 12635903  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
12635904 gggtcggaaaccggtgcgaaa 12635924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 47 - 170
Target Start/End: Complemental strand, 14107482 - 14107358
Alignment:
47 caaagacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctt 145  Q
    ||||||||||  ||| ||||||||| || |||||||||||||||||| ||||| |||||||||||| || |||||| |||||| ||||||||  ||   |    
14107482 caaagacgtattcggggaataccgggttcgattcccaggaggaacaacgcttgaccagtgcacatgcctctacgcatgagccggattagtcgcccattat 14107383  T
146 tggtgagtcggaaaccggtgcgaaa 170  Q
    | ||| |||||||||||||||||||    
14107382 tagtgggtcggaaaccggtgcgaaa 14107358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 75 - 170
Target Start/End: Original strand, 12606445 - 12606540
Alignment:
75 gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| ||||| ||||||| | ||||||||||| |||| || ||||||||||||| ||||||||  |||||||||||||  ||||||||||||||||    
12606445 gatttccagggggaacaacgtttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgagctggaaaccggtgcgaaa 12606540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 47 - 170
Target Start/End: Complemental strand, 3588069 - 3587945
Alignment:
47 caaagacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctt 145  Q
    |||||||||| |||||||||||||| || |||||||| | ||||||| |||||||||||||||||  || |||||| || ||| |||||||||  |||||    
3588069 caaagacgtatccggagaataccgggttcgattcccaaggggaacaacgcttggccagtgcacatacctctacgcatgaaccggattagtcgtcaacctt 3587970  T
146 tggtgagtcggaaaccggtgcgaaa 170  Q
    || ||  |||||||| | |||||||    
3587969 tgatggatcggaaactgatgcgaaa 3587945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 8612094 - 8611974
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||||| ||||||||||| ||||| ||||||  ||||  | |||||| || ||| ||||||||  ||||||||||    
8612094 gacgtacccggggaataccgggttcgattccgaggaggaacaacgcttgaccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggt 8611995  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||| |||||||||||||||    
8611994 gggtcagaaaccggtgcgaaa 8611974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 29333258 - 29333139
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||| | ||||||||| || |||| ||||| ||||||| | ||||||||||| |||| || |||||| ||||||||| |||||| ||||||||||    
29333258 gacgtacccagggaataccgggttcgatttccagg-ggaacaacgtttggccagtgcgcatgcctctacgcatgagccgaatcagtcgtccacctttggt 29333160  T
150 gagtcggaaaccggtgcgaaa 170  Q
      ||||| |||||||||||||    
29333159 aggtcggtaaccggtgcgaaa 29333139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 47 - 170
Target Start/End: Complemental strand, 29444889 - 29444765
Alignment:
47 caaagacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctt 145  Q
    ||||||||||||||| | ||||||| || |||| | ||| ||||||| ||||||||||||| |||| || |||||| |||||| |||||| || || |||    
29444889 caaagacgtacccgggggataccgggttcgatttctagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagttgtccatctt 29444790  T
146 tggtgagtcggaaaccggtgcgaaa 170  Q
    ||||| |||||||||  ||||||||    
29444789 tggtgggtcggaaactagtgcgaaa 29444765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 86 - 170
Target Start/End: Complemental strand, 30788937 - 30788853
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||| | ||||||||||| |||| || || |||||||||| ||||||||  ||||||||||| |||||||||||||||||||    
30788937 ggaacaacgtttggccagtgcgcatgcctctaggcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 30788853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 76 - 170
Target Start/End: Original strand, 31129193 - 31129287
Alignment:
76 attcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| |||| ||| ||| ||||||| ||||| |||| || |||||| |||||  |||||| || |||||||||||||||||||||||||||||||    
31129193 attcacagggggagcaacgcttggctagtgcgcatgcctctacgcatgagccagattagttgtgcacctttggtgagtcggaaaccggtgcgaaa 31129287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 70 - 171
Target Start/End: Complemental strand, 8149896 - 8149796
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||| ||||| ||||||  ||| ||| |||||||| || ||||||  ||||||||||||||| ||||||||||| || |||||||||||||||    
8149896 ggttcgattcctaggag-aacaatatttgaccaatgcacatgcctctacgcattagccgaattagtcgtccacctttggtgggttggaaaccggtgcgaa 8149798  T
170 aa 171  Q
    ||    
8149797 aa 8149796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 87 - 171
Target Start/End: Complemental strand, 2271386 - 2271302
Alignment:
87 gaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaaa 171  Q
    |||||| |||| |||||||| ||||||| ||||||||||||| ||||||||| |||||||| || ||| |||||| |||| ||||    
2271386 gaacaacgcttagccagtgcgcatgtctctacgcacgagccggattagtcgtccacctttgatgggtcagaaaccagtgcaaaaa 2271302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 13468923 - 13469043
Alignment:
51 gacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||| ||||  ||||| ||| ||||||| | |||| ||||||||||| || ||||||||||||  ||||||||  |||| |||||    
13468923 gacgtatccggggaataccaggttcaattcctagggggaacaacgattggtcagtgcacatgcctctacgcacgagccagattagtcgcccaccattggt 13469022  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | || ||||||||||||||||    
13469023 gggttggaaaccggtgcgaaa 13469043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 34954739 - 34954619
Alignment:
51 gacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||||| || ||||||| |||| ||||| |||| ||||||| | |||||||||||||||  || |||||| |||||  ||||||||| |||||||| |    
34954739 gacgtacctggggaataccaggttcgattctcagggggaacaacgtttggccagtgcacatacctctacgcatgagccagattagtcgtccacctttgat 34954640  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||||||||||  |||||||    
34954639 gggtcggaaaccaatgcgaaa 34954619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 81 - 170
Target Start/End: Complemental strand, 13036093 - 13036004
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| |||||||  |||||||||||| |||| || |||||| |||||  ||||||||| |||  |||||| |||||||||||||||||||    
13036093 cagggggaacaacacttggccagtgcgcatgcctctacgcatgagccagattagtcgtccactattggtgggtcggaaaccggtgcgaaa 13036004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 8932671 - 8932771
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| |||||||  |||||| ||||| |||| || |||||| |||||| |||| ||   |||||||| || ||||||||||||||||||    
8932671 ggttcgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatgagccggattaatcacccacctttgatgggtcggaaaccggtgcgaa 8932770  T
170 a 170  Q
    |    
8932771 a 8932771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 8944137 - 8944237
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| |||||||  |||||| ||||| |||| || |||||| |||||| |||| ||   |||||||| || ||||||||||||||||||    
8944137 ggttcgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatgagccggattaatcacccacctttgatgggtcggaaaccggtgcgaa 8944236  T
170 a 170  Q
    |    
8944237 a 8944237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 86 - 170
Target Start/End: Complemental strand, 10311553 - 10311469
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||| ||||||||||||| ||||||| ||||||||||    |||||||| ||||| |||||| |||| |||| |||||||||    
10311553 ggaacaacgcttggccagtgcgcatgtctctacgcacgagttagattagtcgctcaccattggtgggtcgaaaactggtgcgaaa 10311469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 116 - 170
Target Start/End: Complemental strand, 14783474 - 14783420
Alignment:
116 tacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||| |||||| ||||||||| |||| |||||| |||||||||||||||||||    
14783474 tacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaa 14783420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 86 - 137
Target Start/End: Original strand, 13391312 - 13391363
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcg 137  Q
    ||||||||| ||||||||||| |||| || ||||||||||||| ||||||||    
13391312 ggaacaatgtttggccagtgcgcatgcctctacgcacgagccggattagtcg 13391363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 170
Target Start/End: Original strand, 30410460 - 30410555
Alignment:
75 gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||| ||||||||||||  |||  ||||||| |||| || |||||| |||| | |||| ||| ||| |||||||| ||||||||||| |||||||    
30410460 gattctcaggaggaacaacacttaaccagtgcgcatgcctctacgcatgagctggattaatcgctcatctttggtgggtcggaaaccgatgcgaaa 30410555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 70 - 147
Target Start/End: Original strand, 33940021 - 33940098
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttg 147  Q
    |||||||||| ||||||||||||| |||  ||| ||| |||| || ||| ||||||||| ||||||||| || |||||    
33940021 ggtttgattctcaggaggaacaatacttaaccattgcgcatgcctctacacacgagccggattagtcgtccatctttg 33940098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 9179856 - 9179736
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||| | ||||||||| || |||||||||| |||||||  |||| |||||   |||  || |||||| |||| | ||||||||| ||||||||||    
9179856 gacgtacccagggaataccgggttcgattcccagggggaacaacacttgaccagtatgcatacctctacgcatgagctggattagtcgtccacctttggt 9179757  T
150 gagtcggaaaccggtgcgaaa 170  Q
    |  ||||||| |||| |||||    
9179756 ggatcggaaatcggtccgaaa 9179736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 61)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 47078449 - 47078569
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||||||||| ||||||| |||||||||||||||||| || ||||||||||||| |||||||| ||||| |||||    
47078449 gacgtacccggggaataccgggttcgattcccagggggaacaacgcttggccagtgcacatgcctctacgcacgagccggattagtcgctcaccattggt 47078548  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||| ||||||||    
47078549 gggtcggaaaccagtgcgaaa 47078569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 4738629 - 4738729
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||| ||||||||||||| |||| |||||||| ||||||| |||||| |||| ||||||||||| ||||||||||| ||||||||||||||||||    
4738629 ggttcgatttccaggaggaacaacgctttgccagtgcgcatgtctctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgcgaa 4738728  T
170 a 170  Q
    |    
4738729 a 4738729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 38166038 - 38166138
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| ||||||| ||||||||||||| |||| || ||||||||||||| ||||||||  ||||||||||| ||||||||||||||||||    
38166038 ggttggattcccagggggaacaacgcttggccagtgcgcatggctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaa 38166137  T
170 a 170  Q
    |    
38166138 a 38166138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 42722697 - 42722577
Alignment:
51 gacgtacccggagaataccggtttga-ttcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||||||||  |||||||| || | |||||||||||||||| ||||||||||||| |||| || |||||| |||||| ||||||||||||||||| ||    
42722697 gacgtacccgggaaataccgggttcaattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagt 42722598  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||| ||||||||||||||    
42722597 gggtcgaaaaccggtgcgaaa 42722577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 53599051 - 53599171
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||||||||||||||||| | ||||||||||| |||| || |||||| |||||| |||| |||||||||||| ||    
53599051 gacgtacccggggaataccgggttcgattcccaggaggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacctttagt 53599150  T
150 gagtcggaaaccggtgcgaaa 170  Q
    |  ||||||||||||||||||    
53599151 ggatcggaaaccggtgcgaaa 53599171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 2559298 - 2559418
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||||| || ||||||||| || |||| | ||||||||||| ||||||||||||| |||| || ||||||| ||||| |||| |||| ||||||||||    
2559298 gacgtacctggggaataccggattcgatttctaggaggaacaacgcttggccagtgcgcatgcctctacgcacaagccggattactcgtccacctttggt 2559397  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
2559398 gggtcggaaaccggtgcgaaa 2559418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 16450311 - 16450411
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| ||||||| |||||||||||||||||| || |||||| |||||  ||||||||| ||||||||||  ||||||||||||||||||    
16450311 ggttcgattcccagggggaacaacgcttggccagtgcacatgcctctacgcatgagccagattagtcgtccacctttggtaggtcggaaaccggtgcgaa 16450410  T
170 a 170  Q
    |    
16450411 a 16450411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 38168248 - 38168367
Alignment:
51 gacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||| |||| |||||| | ||||||||| ||||||||||||| |||| || |||||| |||||| ||||||||||||||||| ||    
38168248 gacgtacccggggaataccaggttcgattcctaagaggaacaacgcttggccagtgc-catgcctctacgcatgagccggattagtcgttcacctttagt 38168346  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | || ||||||||||||||||    
38168347 gggttggaaaccggtgcgaaa 38168367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 75 - 170
Target Start/End: Original strand, 43458629 - 43458724
Alignment:
75 gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||||||||| || ||||||||||||| |||| || |||| |||||||| ||||||||| |||||||| |||||||||||||| |||||||    
43458629 gattcccaggaggaagaacgcttggccagtgcgcatgcctctacggacgagccggattagtcgtccacctttgatgagtcggaaaccgttgcgaaa 43458724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 52 - 170
Target Start/End: Original strand, 43468339 - 43468458
Alignment:
52 acgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtg 150  Q
    |||||||||| ||||||||| || |||||||||| ||||||| ||||||||||||||||| ||| |||||| |||||| ||||||||  ||||  |||||    
43468339 acgtacccggggaataccgggttcgattcccagggggaacaacgcttggccagtgcacatttctctacgcatgagccggattagtcgcccaccagtggtg 43468438  T
151 agtcggaaaccggtgcgaaa 170  Q
     |||||| ||||||||||||    
43468439 ggtcggagaccggtgcgaaa 43468458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 36262885 - 36262767
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||||||||||||| || ||||||||||  |||||| |||||||||||||||||| || |||||||||| || ||||||||  ||||||||||    
36262885 gacgtacccggagaataccgggttcgattcccagg--gaacaacgcttggccagtgcacatgcctctacgcacgagtcggattagtcgcccacctttggt 36262788  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||| ||||||  |||||||    
36262787 gggtcagaaaccaatgcgaaa 36262767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 166
Target Start/End: Complemental strand, 3159589 - 3159473
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||||||||||||| || || | ||||| ||||||| ||||||||||||| |||| || ||||||||||||  |||||||| ||||| |||||    
3159589 gacgtatccggagaataccgggttcgacttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccagattagtcgctcaccattggt 3159490  T
150 gagtcggaaaccggtgc 166  Q
    | |||||||||||||||    
3159489 gggtcggaaaccggtgc 3159473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 5472968 - 5472848
Alignment:
51 gacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||| |||||||||| |||| | ||||| ||||||||||||| |||| || ||||||||||||| ||||||||  ||||||||||    
5472968 gacgtatccggggaataccaggtttgattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggt 5472869  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||| |||| |||||||||    
5472868 gggtcgaaaactggtgcgaaa 5472848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 7246766 - 7246646
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| |||||| || || |||||| ||  ||||||| ||||||||||||| |||| || |||||| |||||| ||||||||  ||||||||||    
7246766 gacgtacccggggaatactgggttcgattcctagtgggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggt 7246667  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
7246666 gggtcggaaaccggtgcgaaa 7246646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 13073529 - 13073649
Alignment:
51 gacgtacccggagaataccg-gtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||||| ||||||||||| ||| |||||||| | ||||||||| ||||||||||| |||  || |||||| || ||  |||||||||| |||||||||    
13073529 gacgtacctggagaataccgagttcgattcccatggggaacaatgtttggccagtgcgcatacctctacgcatgaaccagattagtcgtttacctttggt 13073628  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
13073629 gggtcggaaaccggtgcgaaa 13073649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 29895778 - 29895898
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || |||||||||| |||||||  |||||||||||| |||| || |||||| |||||| ||||||||| |||| |||||    
29895778 gacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggt 29895877  T
150 gagtcggaaaccggtgcgaaa 170  Q
    |  ||||||||||||||||||    
29895878 ggttcggaaaccggtgcgaaa 29895898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 48 - 170
Target Start/End: Complemental strand, 47682504 - 47682382
Alignment:
48 aaagacgtacccggagaataccgg-tttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcaccttt 146  Q
    ||||||||| ||||||||||  |  |||||||| |||| |||| || | ||||||||||||||||||| |||||||||||||  |||||||  |||||||    
47682504 aaagacgtatccggagaatattgaatttgattctcagg-ggaataacgtttggccagtgcacatgtctctacgcacgagccgggttagtcgcccaccttt 47682406  T
147 ggtgagtcggaaaccggtgcgaaa 170  Q
    |||| |||||||||||||||||||    
47682405 ggtgggtcggaaaccggtgcgaaa 47682382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 86 - 171
Target Start/End: Complemental strand, 40780945 - 40780860
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaaa 171  Q
    ||||||| |||||| |||||| |||| || |||||| |||||| ||||||||| ||||||||||| ||||||||||||||||||||    
40780945 ggaacaacgcttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaaa 40780860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 6779202 - 6779322
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||||| |||||||||||| || |||||||||| |||||||  | |||||||||| |||| || || ||| |||||| ||||||||| ||||||||||    
6779202 gacgtacctggagaataccgggttcgattcccagggggaacaacacctggccagtgcgcatgcctctatgcatgagccggattagtcgtccacctttggt 6779301  T
150 gagtcggaaaccggtgcgaaa 170  Q
    || |||||| ||| |||||||    
6779302 gaatcggaacccgatgcgaaa 6779322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 20128320 - 20128420
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| ||||| |||| ||||||||||||||||||||| |||| || |||||||||||   ||||||||| |||| |||||| ||| ||||||||||||||    
20128320 ggttcgattctcagggggaacaatgcttggccagtgcgcatgcctttacgcacgagctagattagtcgtccaccattggtgggtcagaaaccggtgcgaa 20128419  T
170 a 170  Q
    |    
20128420 a 20128420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 36145335 - 36145215
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||||||||| | ||||| |||||  |||||| |||| || ||| || |||||| ||||||||| |||||||| |    
36145335 gacgtacccggggaataccgggttcgattcccaggggaaacaacgcttgatcagtgcgcatgcctctacacatgagccggattagtcgtccacctttgat 36145236  T
150 gagtcggaaaccggtgcgaaa 170  Q
    || ||||||||||||||||||    
36145235 gaatcggaaaccggtgcgaaa 36145215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 59 - 170
Target Start/End: Original strand, 38075432 - 38075544
Alignment:
59 cggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcgga 157  Q
    ||||||||||||| || ||||| |||| | ||||| ||||||||||||| |||| || |||||| ||||||||||| | || ||||||||||| ||||||    
38075432 cggagaataccgggttcgattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcatgagccgaattaattgtccacctttggtgggtcgga 38075531  T
158 aaccggtgcgaaa 170  Q
    ||||| |||||||    
38075532 aaccgatgcgaaa 38075544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 55921025 - 55921145
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||| |||||| ||||||||| || |||||||||| |||||||  ||||| |||||| |||| || |||| | |||||| |||| ||| |||||||||||    
55921025 gacgcacccggggaataccgggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgtatgagccggattaatcgctcacctttggt 55921124  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
55921125 gggtcggaaaccggtgcgaaa 55921145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 51 - 165
Target Start/End: Original strand, 8889013 - 8889128
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || |||||| ||| |||||||  ||||| |||||| |||| || |||||| |||||| ||||||||| ||||||||||    
8889013 gacgtatccggggaataccgggttcgattcctagggggaacaacacttgggcagtgcgcatggctctacgcatgagccggattagtcgtccacctttggt 8889112  T
150 gagtcggaaaccggtg 165  Q
    | ||||||||||||||    
8889113 gggtcggaaaccggtg 8889128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 81 - 171
Target Start/End: Original strand, 14859313 - 14859403
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaaa 171  Q
    |||||||||||||| ||| ||||||| ||||||| ||||||||||||  ||||||| | |||||||| || ||||||||| ||||||||||    
14859313 caggaggaacaatgtttgaccagtgcgcatgtctctacgcacgagccagattagtcatccacctttgatgtgtcggaaactggtgcgaaaa 14859403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 76 - 166
Target Start/End: Complemental strand, 49260759 - 49260669
Alignment:
76 attcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgc 166  Q
    ||||||| | ||||||| ||||||||||||| |||| || ||||||||||||| ||||||||  ||||||||||| |||||||| ||||||    
49260759 attcccaaggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgaccacctttggtgggtcggaaatcggtgc 49260669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 55 - 159
Target Start/End: Complemental strand, 20532525 - 20532420
Alignment:
55 tacccggagaataccg-gtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagt 153  Q
    |||||||||||||||| ||| |||| ||||||||||||| ||||||||||||| |||| || |||||| |||||| || |||||  |||||||||||  |    
20532525 tacccggagaataccgagttcgatttccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggataagtcgcccacctttggtggat 20532426  T
154 cggaaa 159  Q
    ||||||    
20532425 cggaaa 20532420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 14124027 - 14124127
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| |||||||   ||||||||||| |||| || ||| ||||||||| |||||||| ||||| |||||| || |||||||||||||||    
14124027 ggttcgattcccagggggaacaacatttggccagtgcgcatgcctctacacacgagccggattagtcgctcaccattggtgggttggaaaccggtgcgaa 14124126  T
170 a 170  Q
    |    
14124127 a 14124127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 52950093 - 52950193
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| ||||||| ||||||||||||| |||| || ||| || || ||  ||||||||| ||||||||||| ||||||||||| ||||||    
52950093 ggttcgattcccagggggaacaacgcttggccagtgcgcatgactctacacatgaaccagattagtcgtccacctttggtgggtcggaaaccgatgcgaa 52950192  T
170 a 170  Q
    |    
52950193 a 52950193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 96 - 170
Target Start/End: Original strand, 14567276 - 14567350
Alignment:
96 ttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||||| |||| || ||||||||||||| |||||||| || ||||||||| |||||||| ||||||||||    
14567276 ttggccagtgcgcatgcctctacgcacgagccggattagtcgctcgcctttggtgggtcggaaatcggtgcgaaa 14567350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 70 - 171
Target Start/End: Original strand, 33647732 - 33647833
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||| |||||  |||||| ||||| |||||||||||  || ||||||||| ||  |||||||||||| ||||||||  |||||||||||||||||    
33647732 ggttcgatttccagggagaacaacgcttgaccagtgcacattcctctacgcacgaaccagattagtcgttcatctttggtggatcggaaaccggtgcgaa 33647831  T
170 aa 171  Q
    ||    
33647832 aa 33647833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 168
Target Start/End: Complemental strand, 1940874 - 1940779
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcga 168  Q
    |||| |||||||||| ||||||| ||||||   |||| |||| || ||||||||||||| ||||||||  ||||||||||| |||| ||||||||||||    
1940874 ggttcgattcccagggggaacaacgcttgg---gtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcga 1940779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 15732568 - 15732448
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||||||||||||| || |||||  | | |||||||  ||||||||||||||||| || |||||||| ||   |||||||| ||| |||||||    
15732568 gacgtatccggagaataccgggttcgattcatatggggaacaacacttggccagtgcacatgcctctacgcacgggctagattagtcgctcatctttggt 15732469  T
150 gagtcggaaaccggtgcgaaa 170  Q
    |  ||||||||||||||||||    
15732468 ggatcggaaaccggtgcgaaa 15732448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 47 - 170
Target Start/End: Original strand, 29588723 - 29588847
Alignment:
47 caaagacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctt 145  Q
    ||||||||| |||||  |||||||| || |||||||||| | ||||| ||||||| ||||| |||| || ||||||||||||| ||||||  | |||| |    
29588723 caaagacgtgcccgggaaataccgggttcgattcccaggggaaacaaagcttggctagtgcgcatgcctctacgcacgagccggattagttatccaccat 29588822  T
146 tggtgagtcggaaaccggtgcgaaa 170  Q
    ||||| |||||||| || |||||||    
29588823 tggtgggtcggaaatcgatgcgaaa 29588847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 86 - 162
Target Start/End: Original strand, 30317260 - 30317336
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccg 162  Q
    ||||||| ||||||||||| |  ||| || ||||||||||||||||||||||  ||||||||||| |||||||||||    
30317260 ggaacaacgcttggccagtacgaatgcctctacgcacgagccgaattagtcgcccacctttggtgggtcggaaaccg 30317336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 47 - 170
Target Start/End: Complemental strand, 48015197 - 48015073
Alignment:
47 caaagacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctt 145  Q
    ||||||||||||||  ||||||||| || |||||||||  ||||||| ||||||||||||| || | || ||||||||||||| |||||| |  ||  ||    
48015197 caaagacgtacccgaggaataccgggttcgattcccagtgggaacaacgcttggccagtgcgcaagcctctacgcacgagccggattagtagcccaattt 48015098  T
146 tggtgagtcggaaaccggtgcgaaa 170  Q
    || ||  ||||||||||||||||||    
48015097 tgatggatcggaaaccggtgcgaaa 48015073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 88 - 171
Target Start/End: Original strand, 7741954 - 7742037
Alignment:
88 aacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaaa 171  Q
    ||||| |||||||||||||||||| || ||||||||| ||  ||||||||| || ||||||||| ||| |||| ||||||||||    
7741954 aacaacgcttggccagtgcacatgcctctacgcacgatccagattagtcgtccatctttggtgaatcgaaaactggtgcgaaaa 7742037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 95 - 170
Target Start/End: Original strand, 31588722 - 31588797
Alignment:
95 cttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||||| ||||||| |||||| |||||| |||||||| |||| |||||||  |||||||||| |||||||    
31588722 cttggccagtgcgcatgtctctacgcatgagccggattagtcgctcacttttggtggatcggaaaccgatgcgaaa 31588797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 94 - 172
Target Start/End: Complemental strand, 6032719 - 6032641
Alignment:
94 gcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaaag 172  Q
    ||||| ||||||| |||| || |||| | |||||| |||||||||  |||||||||| |||||||||||||||||||||    
6032719 gcttgaccagtgctcatgcctctacgaatgagccggattagtcgtctacctttggtgggtcggaaaccggtgcgaaaag 6032641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 51 - 143
Target Start/End: Original strand, 1446817 - 1446910
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacc 143  Q
    |||||| |||| ||||||||| || |||||||||| |||||||  |||||||||||| |||| || |||||| |||||| ||||||||| ||||    
1446817 gacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacc 1446910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 54 - 170
Target Start/End: Original strand, 14858705 - 14858821
Alignment:
54 gtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgag 152  Q
    |||||||||||||||||| || | |||||||| ||| ||| ||||| ||||||| ||||||| |||| ||||| |  |||| |||| |||||||| || |    
14858705 gtacccggagaataccgggttcggttcccagggggatcaa-gcttgaccagtgcgcatgtctctacgtacgagtcagattattcgtccacctttgatggg 14858803  T
153 tcggaaaccggtgcgaaa 170  Q
    || |||||||||||||||    
14858804 tcagaaaccggtgcgaaa 14858821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 77 - 170
Target Start/End: Original strand, 17080061 - 17080154
Alignment:
77 ttcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||| | ||||||| ||||||||||||| |||| || |||||| |||||| ||||||||  |||||||| ||  ||| ||||||||||||||    
17080061 ttcccatggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcacacctttgatggatcgaaaaccggtgcgaaa 17080154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 169
Target Start/End: Complemental strand, 295652 - 295534
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||| | || ||||||||| |||||||| | ||||||||||| |||| || ||||||||| ||  ||||||||| |||| |||||    
295652 gacgtatccggggaataccagattcgattcccag-aggaacaacgtttggccagtgcgcatgcctctacgcacgaaccagattagtcgtccaccgttggt 295554  T
150 gagtcggaaaccggtgcgaa 169  Q
    | ||  ||||||||||||||    
295553 gggtttgaaaccggtgcgaa 295534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 76 - 170
Target Start/End: Complemental strand, 3574540 - 3574448
Alignment:
76 attcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||  ||||||  |||||||||||| |||| || |||||||||| || |||||||| ||||||| |||  |||||||||||||| ||||    
3574540 attcccagggagaacaacacttggccagtgcgcatgcctctacgcacgagtcggattagtcgctcaccttaggt--gtcggaaaccggtgagaaa 3574448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 86 - 169
Target Start/End: Original strand, 21429328 - 21429411
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    ||||||| | || |||||||| |||| || |||||||||| |  | ||||||| ||||||||||| ||||||||||||||||||    
21429328 ggaacaacgtttagccagtgcgcatgcctctacgcacgagtcagactagtcgtccacctttggtgggtcggaaaccggtgcgaa 21429411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 84 - 170
Target Start/End: Original strand, 21192665 - 21192751
Alignment:
84 gaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||| | | ||||||||| |||| || |||||||||| || |||| |||  ||| |||||||||||| ||||||||||||||    
21192665 gaggaacaacgttgggccagtgcgcatgcctctacgcacgagtcggattaatcgcccacatttggtgagtcgaaaaccggtgcgaaa 21192751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 170
Target Start/End: Complemental strand, 2686516 - 2686455
Alignment:
109 atgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||| ||| || |||||||||||||||| ||||||| ||| || ||||||||||||||||    
2686516 atgtctctacacatgagccgaattagtcgtccaccttttgtgggttggaaaccggtgcgaaa 2686455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 86 - 170
Target Start/End: Original strand, 6862251 - 6862334
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| ||| ||||| |||||| ||||||| ||||||  || ||||||||||  |||||||||||  |||||||||||||||||||    
6862251 ggaataatacttggtcagtgcgcatgtctctacgcaa-agtcgaattagtcactcacctttggttggtcggaaaccggtgcgaaa 6862334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 24166461 - 24166561
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||| | | ||||| | ||||||||||| |||| || ||||||||||||  |||||||   |||||||| ||  |||||||||||||||||    
24166461 ggttcgattcccaagggaaacaacgtttggccagtgcgcatgcctctacgcacgagccagattagtcacccacctttgatggatcggaaaccggtgcgaa 24166560  T
170 a 170  Q
    |    
24166561 a 24166561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 130 - 170
Target Start/End: Complemental strand, 25406603 - 25406563
Alignment:
130 attagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||||||||||| || |||||||||||||||||||    
25406603 attagtcgttcacctttgatgggtcggaaaccggtgcgaaa 25406563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 87 - 171
Target Start/End: Complemental strand, 48352592 - 48352508
Alignment:
87 gaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaaa 171  Q
    |||||| | |||||||||||||||| ||   | ||||||||| ||||||||| || ||||| ||||||||| ||| |||||||||    
48352592 gaacaacgtttggccagtgcacatgcctcctcacacgagccggattagtcgtccatctttgatgagtcggagaccagtgcgaaaa 48352508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 59 - 170
Target Start/End: Complemental strand, 48834811 - 48834700
Alignment:
59 cggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcgga 157  Q
    ||||||||||||| || |||| ||||| |||| ||| || |||||||||||||| || ||  || ||| || ||||||||   |||||||||| ||||||    
48834811 cggagaataccgggttcgatttccagg-ggaataatactaggccagtgcacatgcctctatacatgagtcggattagtcgcctacctttggtgggtcgga 48834713  T
158 aaccggtgcgaaa 170  Q
    |||||||||||||    
48834712 aaccggtgcgaaa 48834700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 58 - 160
Target Start/End: Original strand, 3507269 - 3507371
Alignment:
58 ccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcgg 156  Q
    |||||||||| ||| || |||||||| | ||||||| ||||||| ||||| | || || ||| ||||||||| ||||||||| |||||||||||  ||||    
3507269 ccggagaatatcgggttcgattcccaag-ggaacaacgcttggctagtgcgcgtgcctctacacacgagccggattagtcgtccacctttggtggatcgg 3507367  T
157 aaac 160  Q
    ||||    
3507368 aaac 3507371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 47 - 170
Target Start/End: Original strand, 20421761 - 20421884
Alignment:
47 caaagacgtacccggagaataccggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcaccttt 146  Q
    |||||||||| | || |||||| |||| |||| ||||| |||||||  |||||||||||| |||| || |||||| |||||  |||| |||| || | ||    
20421761 caaagacgtatctggggaatactggttcgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccagattaatcgtccatcatt 20421860  T
147 ggtgagtcggaaaccggtgcgaaa 170  Q
    | || |||||||||| || |||||    
20421861 gatgggtcggaaaccagttcgaaa 20421884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 86 - 161
Target Start/End: Complemental strand, 40272415 - 40272340
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaacc 161  Q
    ||||||| ||||||||||||| |||| || ||||||  || || ||| |||||||||| |||||| ||||||||||    
40272415 ggaacaacgcttggccagtgcgcatgcctctacgcataagtcggatttgtcgttcaccattggtgggtcggaaacc 40272340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 137
Target Start/End: Complemental strand, 41339515 - 41339428
Alignment:
51 gacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcg 137  Q
    ||||||||||||||||||| |||| || ||||| | ||||||| ||||||||||||   ||| || |||||||||| || ||||||||    
41339515 gacgtacccggagaataccgggttcgactcccaaggggaacaacgcttggccagtgtgtatgcctctacgcacgagacggattagtcg 41339428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 72 - 170
Target Start/End: Original strand, 18531532 - 18531630
Alignment:
72 tttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||| |||||| |||||||  ||||| |||||| |||| ||  | |||||| ||  |||| |||| ||||||| ||| |||||||||||||||||||    
18531532 tttgatccccagggggaacaacacttggtcagtgcgcatgcctccatgcacgaaccagattattcgtccaccttttgtgggtcggaaaccggtgcgaaa 18531630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 81 - 170
Target Start/End: Original strand, 16645140 - 16645229
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||| |||||| ||||||||||||  |||| || ||| || ||| |  ||||||||  ||||| ||||| |||||||||||||||||||    
16645140 caggaagaacaacgcttggccagtgtgcatgcctctacacatgagtctgattagtcgcccacctgtggtgggtcggaaaccggtgcgaaa 16645229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 27248419 - 27248537
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || || ||||||||||||||| |||||||||  || |||| || |||||| |||||  ||||||||  ||||||||||    
27248419 gacgtatccggggaataccgggttcgagtcccaggaggaacaacgcttggcca--gcgcatgcctctacgcaggagccagattagtcgcccacctttggt 27248516  T
150 gagtcggaaaccggtgcgaaa 170  Q
      ||| ||||| |||| ||||    
27248517 aggtcagaaactggtgtgaaa 27248537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 10541027 - 10541126
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||| ||||| | ||||| ||||||||||||  |||| || ||||||||||||  |||| |||  |||||||| ||  |||||||||||||||||    
10541027 ggttcgatttccaggggaaacaacgcttggccagtgtgcatgcctctacgcacgagccagattaatcg-ccacctttgatggatcggaaaccggtgcgaa 10541125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 170
Target Start/End: Original strand, 33176085 - 33176125
Alignment:
130 attagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||| |||||||||||||| ||||||| ||||||||    
33176085 attagtcgtccacctttggtgagttggaaaccagtgcgaaa 33176125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 36)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 10927596 - 10927716
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||||| ||||||||||| ||||||||||||| |||| || |||||| |||||| ||||||||||||||||| ||    
10927596 gacgtacccggggaataccgggttcgattcctaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagt 10927695  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||||||||||| |||||||    
10927696 gggtcggaaaccgatgcgaaa 10927716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 51 - 171
Target Start/End: Complemental strand, 4479415 - 4479295
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||||| | |||||||||| || |||||||||| ||||||| ||||||||||||| |||| || |||||| |||| | ||||||||| ||||||||||    
4479415 gacgtacctgtagaataccggattcgattcccagg-ggaacaacgcttggccagtgcgcatgcctctacgcatgagctggattagtcgtccacctttggt 4479317  T
150 gagtcggaaaccggtgcgaaaa 171  Q
    | ||||||||||||||||||||    
4479316 gggtcggaaaccggtgcgaaaa 4479295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 6100462 - 6100582
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || |||||||||||||||||| ||||||||||||| |||| |  |||||| |||||| ||||||||||||||||| ||    
6100462 gacgtatccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgccactacgcatgagccggattagtcgttcacctttagt 6100561  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||| |||||| |||||||    
6100562 gggtcgaaaaccgctgcgaaa 6100582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 51 - 171
Target Start/End: Complemental strand, 15884675 - 15884555
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||||| || ||||||||| || |||||||||| |||||||  |||||| ||||| |||| || ||||||||||||| ||||||||  ||||||||||    
15884675 gacgtacctggggaataccgggttcgattcccagg-ggaacaacacttggcaagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggt 15884577  T
150 gagtcggaaaccggtgcgaaaa 171  Q
    | ||||||||||||||||||||    
15884576 gggtcggaaaccggtgcgaaaa 15884555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 75 - 170
Target Start/End: Original strand, 43032916 - 43033011
Alignment:
75 gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||| ||||||| ||||||||||||| |||| || ||| ||||||||| ||||||||  ||||||||||| ||| |||||||||||||||    
43032916 gattcccagggggaacaacgcttggccagtgcgcatgcctctacacacgagccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaa 43033011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 146
Target Start/End: Complemental strand, 1013097 - 1013001
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcaccttt 146  Q
    |||||| |||| ||||||||| || |||||||||| ||||||| ||||||||||| |||||| || |||||| ||||||||||| ||||||||||||    
1013097 gacgtatccggggaataccgggttcgattcccagggggaacaacgcttggccagtacacatgcctctacgcatgagccgaattaatcgttcaccttt 1013001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 2467238 - 2467118
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || |||| ||||| |||||||  |||||||||||| ||||||| || ||| |||||| ||||||||| |||  |||||    
2467238 gacgtatccggggaataccgggttcgatttccagggggaacaactcttggccagtgcgcatgtctctatgcatgagccggattagtcgtccacaattggt 2467139  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
2467138 gtgtcggaaaccggtgcgaaa 2467118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 94 - 170
Target Start/End: Complemental strand, 10535480 - 10535404
Alignment:
94 gcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||| ||||||| |||||||  ||||| ||||||||||||||||||||||||||| |||||||||| |||||||||    
10535480 gcttgaccagtgcgcatgtctccacgcatgagccgaattagtcgttcacctttggtaagtcggaaactggtgcgaaa 10535404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 52 - 170
Target Start/End: Original strand, 2964067 - 2964186
Alignment:
52 acgtacccggagaataccg-gtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtg 150  Q
    |||||||||| |||||||| ||| |||||| | ||||||||| ||||||||| ||  |||| || ||||||||| ||| ||||||||  |||||||||||    
2964067 acgtacccggggaataccgtgttcgattccgatgaggaacaacgcttggccaatgtgcatgcctctacgcacgaaccggattagtcgcccacctttggtg 2964166  T
151 agtcggaaaccggtgcgaaa 170  Q
     ||| |||||||||||||||    
2964167 ggtcagaaaccggtgcgaaa 2964186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 52 - 170
Target Start/End: Original strand, 24837233 - 24837352
Alignment:
52 acgtacccggagaataccg-gtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtg 150  Q
    |||||||||| |||||||| ||| ||||||||||  |||||| ||||||||||||  |||| || || |||||||| | ||||||||| |||||||||||    
24837233 acgtacccggggaataccgtgttcgattcccagggagaacaacgcttggccagtgttcatgcctctaagcacgagcaggattagtcgtccacctttggtg 24837332  T
151 agtcggaaaccggtgcgaaa 170  Q
      |||||||| |||||||||    
24837333 gatcggaaactggtgcgaaa 24837352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 54 - 170
Target Start/End: Original strand, 17981434 - 17981551
Alignment:
54 gtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgag 152  Q
    ||||||||  |||||||| || |||||||||| |||||||  |||| ||||||  |||| || |||||||||| ||||||||| |  || ||||||||||    
17981434 gtacccgggaaataccgggttcgattcccagggggaacaactcttgaccagtgtgcatgcctctacgcacgagtcgaattagttgcccagctttggtgag 17981533  T
153 tcggaaaccggtgcgaaa 170  Q
    ||||||||||||||||||    
17981534 tcggaaaccggtgcgaaa 17981551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 54 - 170
Target Start/End: Original strand, 45521162 - 45521278
Alignment:
54 gtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgag 152  Q
    |||||||| ||||||||| || |||||||||| |||||||  ||||  |||||| |||| || |||||| |||||| |||||||| ||||||||| || |    
45521162 gtacccggggaataccgggttcgattcccagg-ggaacaacacttgatcagtgcgcatgcctctacgcatgagccggattagtcgctcacctttgatggg 45521260  T
153 tcggaaaccggtgcgaaa 170  Q
    ||||||||||||||||||    
45521261 tcggaaaccggtgcgaaa 45521278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 166
Target Start/End: Complemental strand, 44893398 - 44893282
Alignment:
51 gacgtacccggagaataccggtttga-ttcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || | || | ||| ||||||||||||||||||||  |||| || ||||||||||||| |||| ||| ||||| ||| |    
44893398 gacgtacccggggaataccgggttcaatttctagggggaacaatgcttggccagtgtgcatgcctctacgcacgagccggattaatcgctcacccttgat 44893299  T
150 gagtcggaaaccggtgc 166  Q
    | |||||||||||||||    
44893298 gggtcggaaaccggtgc 44893282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 166
Target Start/End: Complemental strand, 68198 - 68102
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgc 166  Q
    |||| ||||| |||||||||||| | |||||||||   |||| || ||| ||||||||| |||| ||||||||||||| || |||||||||||||||    
68198 ggttcgattctcaggaggaacaacgtttggccagtatgcatgcctttacacacgagccggattaatcgttcacctttgatgggtcggaaaccggtgc 68102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 8141112 - 8141212
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||| ||||| | ||||| ||||||||||||| |||| || |||||| |||| ||||||||||| ||| ||||||| ||| ||||||| ||||||    
8141112 ggttcgatttccaggggaaacaacgcttggccagtgcgcatgcctctacgcatgagctgaattagtcgtccacatttggtgggtcagaaaccgatgcgaa 8141211  T
170 a 170  Q
    |    
8141212 a 8141212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 86 - 170
Target Start/End: Complemental strand, 8997628 - 8997544
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||| | || |||||| | |||| ||||||||| |||||  |||||||||||| |||||||| |||||||||||||||||||    
8997628 ggaacaacgtttcgccagttcgcatgcctatacgcatgagccagattagtcgttcatctttggtgggtcggaaaccggtgcgaaa 8997544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 14846566 - 14846685
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || ||||| |||| ||||||||| |||| |||||| |||| || |||||| ||| |  || |||||| ||||||||||    
14846566 gacgtacccggggaataccgggttcgattctcagg-ggaacaatgattggtcagtgcgcatgcctctacgcatgagtcagataagtcgtccacctttggt 14846664  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||| ||||||||||    
14846665 gggtcggaaatcggtgcgaaa 14846685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 43027315 - 43027415
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||||||||||| | ||| ||| ||| |||| || |||||| |||||| ||||||||| || ||||| || ||||||||||| ||||||    
43027315 ggttcgattcccaggaggaacaacgattgtccaatgcgcatgcctctacgcatgagccggattagtcgtccatctttgatgggtcggaaaccgatgcgaa 43027414  T
170 a 170  Q
    |    
43027415 a 43027415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 51 - 127
Target Start/End: Complemental strand, 38922534 - 38922457
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagcc 127  Q
    ||||||||||| ||||||||| || |||||||||  ||||||| ||||||||||||| |||| || ||||||||||||    
38922534 gacgtacccggggaataccgggttcgattcccagagggaacaacgcttggccagtgcgcatgcctttacgcacgagcc 38922457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 86 - 170
Target Start/End: Complemental strand, 11298351 - 11298267
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||  ||| |||||||| |||| || || ||| ||||| ||||| ||| |||||||||||| |||||||||||||||||||    
11298351 ggaacaacacttagccagtgcgcatgcctctatgcatgagccaaattaatcgctcacctttggtgggtcggaaaccggtgcgaaa 11298267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 14666191 - 14666071
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || |||||||||| | |||||  |||||||||||| |||| || ||||||| ||||  ||||||||  |||  |||||    
14666191 gacgtatccggggaataccgggttcgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcacaagccagattagtcgcccacagttggt 14666092  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||| ||||||||||||||    
14666091 gggtcgaaaaccggtgcgaaa 14666071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 16893947 - 16894045
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| ||||| |||| |||| || ||||||||||| |||||| || |||||| |||||| ||| ||||  ||||||||||| ||||||||||||||||||    
16893947 ggttcgattcacagggggaataacgcttggccagtacacatgcctttacgcatgagccggatt-gtcgcccacctttggtg-gtcggaaaccggtgcgaa 16894044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 56 - 137
Target Start/End: Original strand, 6042816 - 6042898
Alignment:
56 acccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcg 137  Q
    |||||| ||||||||| || |||||||| | ||||||| ||||||||||||| |||| ||| ||||| |||||| ||||||||    
6042816 acccggggaataccgggttcgattcccaaggggaacaacgcttggccagtgcgcatgcctaaacgcatgagccggattagtcg 6042898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 76 - 162
Target Start/End: Original strand, 26570940 - 26571026
Alignment:
76 attcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccg 162  Q
    ||||| ||| ||||||| ||||||||||||   |||  | |||||| |||||| ||||||||| |||||||| ||||||||||||||    
26570940 attcctagggggaacaacgcttggccagtgtgtatgcatctacgcatgagccggattagtcgtccacctttgatgagtcggaaaccg 26571026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 81 - 170
Target Start/End: Complemental strand, 16291292 - 16291203
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| |||||||  |||||||||| |||||| || || ||| |||| | |||||||| |||||||||||| |||| ||||||||| ||||    
16291292 cagggggaacaacacttggccagtacacatgcctctatgcatgagctggattagtcgctcacctttggtgggtcgaaaaccggtgtgaaa 16291203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 170
Target Start/End: Complemental strand, 3418601 - 3418513
Alignment:
82 aggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||||  |||||||||||| ||||  | |||||| ||| |  ||||||||| ||||||| ||| ||| |||||||||||||||    
3418601 aggaggaacaacacttggccagtgcgcatgcgtctacgcatgagtcagattagtcgtccacctttagtgggtcagaaaccggtgcgaaa 3418513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 54 - 170
Target Start/End: Original strand, 17845726 - 17845840
Alignment:
54 gtacccggagaataccggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagt 153  Q
    |||| ||| |||||| ||||||||||||||| |||||||  |||||| |||||||||  || ||||||| ||   ||||| |||  |||||| |||| ||    
17845726 gtactcggggaatactggtttgattcccagg-ggaacaacacttggctagtgcacattcctctacgcacaagtttaattaatcgcccacctt-ggtgggt 17845823  T
154 cggaaaccggtgcgaaa 170  Q
    |||||||||||||||||    
17845824 cggaaaccggtgcgaaa 17845840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 58 - 158
Target Start/End: Original strand, 29933770 - 29933870
Alignment:
58 ccggagaataccggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcgga 157  Q
    ||||||||||| |||| ||||||||||  ||||||  |||| |||||| ||||| || |||| | |||||| ||||||||  | |||||| |||||||||    
29933770 ccggagaatacgggttcgattcccagggagaacaacacttgaccagtgtacatgcctctacgtatgagccggattagtcgcacccctttgatgagtcgga 29933869  T
158 a 158  Q
    |    
29933870 a 29933870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 86 - 161
Target Start/End: Original strand, 3567930 - 3568005
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaacc 161  Q
    |||||||  |||| |||||||||||  || |||||| ||||| |||||||| | ||||||||||| ||||||||||    
3567930 ggaacaacacttgaccagtgcacatacctctacgcatgagccaaattagtcatccacctttggtgggtcggaaacc 3568005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 86 - 149
Target Start/End: Original strand, 22958796 - 22958859
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||||||||||| |||||  ||||||| || ||| |||||| ||||||||| ||||||||||    
22958796 ggaacaatgcttggtcagtgtgcatgtctctatgcatgagccggattagtcgtccacctttggt 22958859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 87 - 170
Target Start/End: Original strand, 23895595 - 23895678
Alignment:
87 gaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||| ||||||||||||| |||  || ||||||||||  | |||| |||| |||||||| || ||||||||| |||||||||    
23895595 gaacaacgcttggccagtgcgcatacctctacgcacgagatggattaatcgtccacctttgatgggtcggaaacgggtgcgaaa 23895678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 170
Target Start/End: Original strand, 3692889 - 3692943
Alignment:
116 tacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||| ||||||||||| |||||||||||||||  |||| |||||||| |||||    
3692889 tacgcatgagccgaattaatcgttcacctttggtaggtcgaaaaccggtacgaaa 3692943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 81 - 171
Target Start/End: Complemental strand, 13358045 - 13357955
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaaa 171  Q
    |||| ||||||| | ||||||| ||  |||| || || |||||||||| ||||||||| | ||||| ||| ||||||||||||||| ||||    
13358045 cagggggaacaacgtttggccaatgtgcatgcctctatgcacgagccggattagtcgtccccctttagtgggtcggaaaccggtgcaaaaa 13357955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 170
Target Start/End: Complemental strand, 22212569 - 22212515
Alignment:
116 tacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||| |||| |||||||| ||||||||||||  ||| ||||||||||||||    
22212569 tacgcacgggccggattagtcgctcacctttggtggttcgaaaaccggtgcgaaa 22212515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 130 - 167
Target Start/End: Complemental strand, 4772091 - 4772054
Alignment:
130 attagtcgttcacctttggtgagtcggaaaccggtgcg 167  Q
    ||||||||| ||||||||||| ||||||||||||||||    
4772091 attagtcgtccacctttggtgggtcggaaaccggtgcg 4772054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 162
Target Start/End: Complemental strand, 9860095 - 9860003
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccg 162  Q
    |||| |||||||||| |||||||  |||||||||||  |||| || ||| || |||||  ||||||||| |||| ||||||  ||||||||||    
9860095 ggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacacatgagccagattagtcgtccaccattggtggatcggaaaccg 9860003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 61)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 54261212 - 54261332
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||||| || ||||||||| || |||||| ||||||||||| ||||||||||||| |||| || |||||| |||||| ||||||||||||||||| ||    
54261212 gacgtacctggggaataccgggttcgattcctaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagt 54261311  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
54261312 gggtcggaaaccggtgcgaaa 54261332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 70 - 171
Target Start/End: Complemental strand, 3507634 - 3507533
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    ||||||||||| ||  |||||||  |||||||||||| |||| || ||||||||||||| |||||||| |||||||||||| ||||||||||||||||||    
3507634 ggtttgattcctagagggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaa 3507535  T
170 aa 171  Q
    ||    
3507534 aa 3507533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 15320172 - 15320292
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||| | ||||||||||||| ||||||||||  |||| || ||||||||||||| ||||||||  ||||||||||    
15320172 gacgtacccggggaataccgggttcgatttcgaggaggaacaatgattggccagtgtgcatgcctctacgcacgagccggattagtcgcccacctttggt 15320271  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||| |||||||||||||||    
15320272 gggtcagaaaccggtgcgaaa 15320292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 31072864 - 31072984
Alignment:
51 gacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||||||||||| |||| |||| ||||| ||||||| |||||| ||||||||||| || ||||||||| ||  |||| |||| ||||||||||    
31072864 gacgtacccggagaataccaggttcgatttccagggggaacaacgcttggtcagtgcacatgcctctacgcacgacccagattaatcgtccacctttggt 31072963  T
150 gagtcggaaaccggtgcgaaa 170  Q
      || ||||||||||||||||    
31072964 aggttggaaaccggtgcgaaa 31072984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 45877440 - 45877560
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || |||| ||||| | |||||  ||||||||||||||||| || |||||| |||||| |||||||||||||| ||| |    
45877440 gacgtatccggggaataccgggttcgatttccaggggaaacaacacttggccagtgcacatgcctctacgcatgagccggattagtcgttcaccattgat 45877539  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
45877540 gggtcggaaaccggtgcgaaa 45877560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 47471838 - 47471937
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| ||||||||||||||| ||||| ||||  | |||||| |||||||||||||||| ||||||||||| ||||||||||| ||||||    
47471838 ggttcgattcccagg-ggaacaatgcttggctagtgcgcatgcttctacgcatgagccgaattagtcgtccacctttggtgggtcggaaaccgatgcgaa 47471936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 42 - 170
Target Start/End: Original strand, 47219121 - 47219250
Alignment:
42 ctttgcaaagacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttc 140  Q
    |||| ||| |||||| |||| ||||||| |||| |||||||| | | ||||| ||||||| ||||| |||| || |||||| |||||| ||||||||| |    
47219121 ctttccaaggacgtatccggggaataccaggttcgattcccaagggaaacaacgcttggctagtgcgcatgcctctacgcatgagccggattagtcgtcc 47219220  T
141 acctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||| || |||||||||||||||||||    
47219221 acctttgatgggtcggaaaccggtgcgaaa 47219250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 7328830 - 7328949
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||||||||  |||||||| || |||||||||| |||||||  |||||||||||| |||| || |||||| |||||| ||||||||  ||||||||||    
7328830 gacgtacccgggaaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcct-tacgcatgagccggattagtcgcccacctttggt 7328928  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||| ||||||||||||||    
7328929 gggtcgaaaaccggtgcgaaa 7328949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 26043818 - 26043918
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| ||||||||||  ||||||  |||||||||||| |||| || |||||| |||||| |||||||| |||||||||||||||| |||||||| |||||    
26043818 ggttcgattcccagggagaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgagtcagaaaccggggcgaa 26043917  T
170 a 170  Q
    |    
26043918 a 26043918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 28572312 - 28572212
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| | ||||| |||||||||||   |||| || ||||||||||||| ||||||||  ||||||||||| ||||||||||||||||||    
28572312 ggttcgattcccaggggaaacaacgcttggccagtatgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaa 28572213  T
170 a 170  Q
    |    
28572212 a 28572212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 35315942 - 35316062
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||||||||| ||| || |||||||||| |||||||  |||||||||||| |||| || |||||| |||| | ||||||||  ||| ||||||    
35315942 gacgtacccggagaatatcgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagctggattagtcgcccacttttggt 35316041  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||||||||||| |||||||    
35316042 gggtcggaaaccgatgcgaaa 35316062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 70 - 166
Target Start/End: Complemental strand, 55069780 - 55069684
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgc 166  Q
    ||||||||||| |   ||||||| | |||||||||||||||| || ||||||||||||| |||| ||| |||||||||||| |||||||||||||||    
55069780 ggtttgattcctatagggaacaacgtttggccagtgcacatgcctctacgcacgagccggattaatcgctcacctttggtgggtcggaaaccggtgc 55069684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 51 - 167
Target Start/End: Original strand, 10040543 - 10040659
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||| ||| || ||||| |||| ||||||| ||||||||||||| |||| || ||||||||||||| | | ||||| ||||||||||    
10040543 gacgtacccggggaatatcgggttcgattctcagg-ggaacaacgcttggccagtgcgcatgcctctacgcacgagccggaatggtcgtccacctttggt 10040641  T
150 gagtcggaaaccggtgcg 167  Q
    | || |||||||||||||    
10040642 gggttggaaaccggtgcg 10040659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 70 - 171
Target Start/End: Original strand, 53649733 - 53649834
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| ||||| ||||  ||||||  |||||||||||| | ||||| |||||| |||||| |||||||||||||||||| ||  |||||||||||||||||    
53649733 ggttcgattctcagggtgaacaacacttggccagtgcgcctgtctctacgcatgagccggattagtcgttcacctttgatggatcggaaaccggtgcgaa 53649832  T
170 aa 171  Q
    ||    
53649833 aa 53649834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 7650233 - 7650333
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||| ||||| |||||||  |||||||||| |  |||||| ||||||||||||| ||||||||  ||||||||||| || |||||||||||||||    
7650233 ggttcgatttccagggggaacaacacttggccagtacgaatgtctctacgcacgagccggattagtcgcccacctttggtgggttggaaaccggtgcgaa 7650332  T
170 a 170  Q
    |    
7650333 a 7650333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 166
Target Start/End: Complemental strand, 15795614 - 15795499
Alignment:
51 gacgtacccggagaataccg-gtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| |||||||| ||| |||||||||| ||||||| |||||| |||||| |||| || ||||||||||| ||||||||||  ||||  ||||    
15795614 gacgtacccggggaataccgagttcgattcccagg-ggaacaacgcttggtcagtgcgcatgcctctacgcacgagctgaattagtcgcccaccaatggt 15795516  T
150 gagtcggaaaccggtgc 166  Q
    | |||| ||||||||||    
15795515 gggtcgaaaaccggtgc 15795499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 29135899 - 29136019
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || |||||||||| |||||||  |||||||||||| |||| || |||||| |||||| ||||||| | |||| |||||    
29135899 gacgtatccggggaataccggattcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcttccaccattggt 29135998  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | || |||||||||| |||||    
29135999 gggttggaaaccggtacgaaa 29136019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 47 - 170
Target Start/End: Complemental strand, 35998695 - 35998572
Alignment:
47 caaagacgtacccggagaataccgg-tttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctt 145  Q
    ||||||||||||||||||||||||| ||||||| | ||| | ||||| |||||  ||||||||||| || ||||||||||  | |||| |||| ||||||    
35998695 caaagacgtacccggagaataccgggtttgatttcgagg-gaaacaacgcttgatcagtgcacatgcctctacgcacgagttggattaatcgtccacctt 35998597  T
146 tggtgagtcggaaaccggtgcgaaa 170  Q
    | ||| ||| |||||||||||||||    
35998596 tagtgggtcagaaaccggtgcgaaa 35998572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 86 - 170
Target Start/End: Complemental strand, 47749190 - 47749106
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||  |||||||||||| |||| || ||||||||||||||||||||||  ||||||||||  ||||||||||| |||||||    
47749190 ggaacaactcttggccagtgcgcatgcctctacgcacgagccgaattagtcgcccacctttggtaggtcggaaaccgatgcgaaa 47749106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 49 - 170
Target Start/End: Complemental strand, 45450569 - 45450448
Alignment:
49 aagacgtacccggagaataccgg-tttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttg 147  Q
    |||||||| ||| ||||||| || ||||||| ||||| ||||||||||||| ||||||| |||| || ||||||  |||   ||||||||| ||||||||    
45450569 aagacgtatccgtagaatactgggtttgatttccagg-ggaacaatgcttgaccagtgcgcatgcctctacgcataagctagattagtcgtccacctttg 45450471  T
148 gtgagtcggaaaccggtgcgaaa 170  Q
     ||||| ||||||||||||||||    
45450470 atgagttggaaaccggtgcgaaa 45450448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 81 - 170
Target Start/End: Original strand, 19146978 - 19147067
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||||| ||||||||||||   ||  || || |||||||| | ||||||||| ||||||||||| |||||||||||||||||||    
19146978 caggaggaacaacgcttggccagtgtgtatccctctatgcacgagctggattagtcgtccacctttggtgggtcggaaaccggtgcgaaa 19147067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 3136814 - 3136695
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || ||||  |||| |||||||  ||||| |||||| |||| || |||||| ||| || ||||||||| ||||||||||    
3136814 gacgtacccggggaataccggattcgattttcagg-ggaacaacacttgggcagtgcgcatgcctctacgcatgagtcggattagtcgtccacctttggt 3136716  T
150 gagtcggaaaccggtgcgaaa 170  Q
      |||||||||||||||||||    
3136715 tggtcggaaaccggtgcgaaa 3136695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 42 - 149
Target Start/End: Original strand, 3755547 - 3755655
Alignment:
42 ctttgcaaagacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttc 140  Q
    |||| ||| |||||| |||| ||||||||  || |||||||||||||||||| | ||| ||||||| ||||||| |||||| |||||| |||||||||      
3755547 cttttcaaggacgtatccggggaataccgacttcgattcccaggaggaacaacgtttgaccagtgcgcatgtctctacgcatgagccggattagtcgtct 3755646  T
141 acctttggt 149  Q
    |||||||||    
3755647 acctttggt 3755655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 25294946 - 25295066
Alignment:
51 gacgtacccggagaataccgg-tttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| |||||||| | || | |||||  |||||||||||| |||| || || ||| |||||| ||||||||| |||| |||||    
25294946 gacgtatccggggaataccgggtttgattctctggggaaacaacacttggccagtgcgcatgcctctatgcatgagccggattagtcgtccaccattggt 25295045  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | || ||||||||||||||||    
25295046 gggttggaaaccggtgcgaaa 25295066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 26362068 - 26361968
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    ||||||||||||| | ||||||| | |||| |||||  |||| || ||||||||||||| ||||||||  |||||||| || |||||||||||||| |||    
26362068 ggtttgattcccaaggggaacaacgtttggtcagtgtgcatgcctctacgcacgagccggattagtcgcacacctttgatgggtcggaaaccggtgtgaa 26361969  T
170 a 170  Q
    |    
26361968 a 26361968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 30045827 - 30045927
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||| ||| ||||||| ||||||||||||| ||||||| |||||||||| |  ||||||||| |||||||| || |||| ||||  |||||||    
30045827 ggttcgattcctagggggaacaacgcttggccagtgcgcatgtctctacgcacgagtctgattagtcgtccacctttgatgggtcgtaaactagtgcgaa 30045926  T
170 a 170  Q
    |    
30045927 a 30045927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 30767348 - 30767248
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||| ||||| |||||||  |||||||||||  |||| || ||||||||||||| ||||||||  ||||||||||| |||||||||  |||||||    
30767348 ggttcgatttccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaactagtgcgaa 30767249  T
170 a 170  Q
    |    
30767248 a 30767248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 51 - 158
Target Start/End: Complemental strand, 52364921 - 52364813
Alignment:
51 gacgtacccggagaataccg-gtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| |||||||| ||| ||||||||| |||||||| ||||| ||||||| |||| || ||||||||||| | |||| ||||  ||||||| |    
52364921 gacgtacccggggaataccgagttcgattcccagaaggaacaacgcttgaccagtgcgcatgcctctacgcacgagctggattaatcgtctacctttgat 52364822  T
150 gagtcggaa 158  Q
    | |||||||    
52364821 gggtcggaa 52364813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 75 - 170
Target Start/End: Original strand, 928611 - 928706
Alignment:
75 gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||| |||| |||||||  |||| ||||||| |||| |  ||||||||||||| ||||||| | |||||||||||||||| ||| ||||||||||    
928611 gattctcagggggaacaacacttgaccagtgcgcatgccgctacgcacgagccggattagtcatccacctttggtgagtcgaaaatcggtgcgaaa 928706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 137
Target Start/End: Original strand, 28242264 - 28242351
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcg 137  Q
    |||||| |||||||||||||| || |||| ||||||||||||||| |||||||||||||||| || || ||| ||| || ||||||||    
28242264 gacgtatccggagaataccgggttagattgccaggaggaacaatgtttggccagtgcacatgcctctatgcatgaggcggattagtcg 28242351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 70 - 166
Target Start/End: Original strand, 19873373 - 19873474
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatg--tcta----tacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccgg 163  Q
    |||||||||||||| |||||||||||||||||||||| ||||  ||||    ||||||||||||| ||||||||| || |||| ||| ||||||||| ||    
19873373 ggtttgattcccag-aggaacaatgcttggccagtgcgcatgcctctacctctacgcacgagccggattagtcgtccatcttttgtgggtcggaaactgg 19873471  T
164 tgc 166  Q
    |||    
19873472 tgc 19873474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 116 - 170
Target Start/End: Complemental strand, 36043729 - 36043675
Alignment:
116 tacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||||||| ||||||||  ||||||||||| |||||||||||||||||||    
36043729 tacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 36043675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 70 - 148
Target Start/End: Complemental strand, 47303590 - 47303512
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttgg 148  Q
    |||||||||||||||||||||||  ||||| ||||||||||| || ||| || |||||| |||||||||  ||||||||    
47303590 ggtttgattcccaggaggaacaacacttggtcagtgcacatgcctctacacatgagccggattagtcgtcaacctttgg 47303512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 100 - 170
Target Start/End: Complemental strand, 49021274 - 49021204
Alignment:
100 ccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||| |||| || |||||| |||||| ||||||||| |||| |||||| |||||||||||||||||||    
49021274 ccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaa 49021204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 70 - 172
Target Start/End: Complemental strand, 50405704 - 50405602
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||| ||| | ||||| ||||| ||||||| |||| || |||||||||| || ||||||||  |||| |||||| ||||||||||||||| ||    
50405704 ggttcgattccgaggggaaacaacgcttgaccagtgcgcatgcctctacgcacgagtcggattagtcgcccaccattggtgggtcggaaaccggtgcaaa 50405605  T
170 aag 172  Q
    |||    
50405604 aag 50405602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 11687230 - 11687169
Alignment:
51 gacgtacccggagaataccgg-tttgattcccaggaggaacaatgcttggccagtgcacatg 111  Q
    |||||||| |||||||||||| |||||||| |||| ||||||||||||||||||||| ||||    
11687230 gacgtacctggagaataccgggtttgattctcagggggaacaatgcttggccagtgcgcatg 11687169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 58 - 170
Target Start/End: Original strand, 13893919 - 13894032
Alignment:
58 ccggagaataccggtttg-attcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcgg 156  Q
    |||| ||||||||| ||| ||| ||||| ||||||| |||||| || ||| |||| || ||| ||||||||| ||||||||  |||||||||||  |||     
13893919 ccggggaataccgggttggatttccagggggaacaacgcttggtcaatgcgcatgcctctacacacgagccggattagtcgcccacctttggtggatcga 13894018  T
157 aaaccggtgcgaaa 170  Q
    ||||||||||||||    
13894019 aaaccggtgcgaaa 13894032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 7310804 - 7310704
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||  |||||||  |||| || |||  |||| || ||||||||||||| |||||||| ||| |||||||| ||||||||||| ||||||    
7310804 ggttcgattcccagtgggaacaacacttgcccggtgtgcatgcctctacgcacgagccggattagtcgctcatctttggtgggtcggaaaccgatgcgaa 7310705  T
170 a 170  Q
    |    
7310704 a 7310704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 29127925 - 29128025
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||| |||||  ||||||  ||||| |||||| |||| || |||||| |||||| ||||||||  ||||||||||| ||||||||||| ||||||    
29127925 ggttcgatttccagggagaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccgatgcgaa 29128024  T
170 a 170  Q
    |    
29128025 a 29128025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 51 - 166
Target Start/End: Complemental strand, 35923744 - 35923628
Alignment:
51 gacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||||| |||||||||| |||| |||||  ||| ||||||| | ||||||||||| |||| || || ||||||| |||||||||||| || ||||| |    
35923744 gacgtacctggagaataccaggttcgattcatagggggaacaacgtttggccagtgcgcatgcctctaagcacgagtcgaattagtcgtccatctttgat 35923645  T
150 gagtcggaaaccggtgc 166  Q
    |  ||| ||||||||||    
35923644 ggatcgaaaaccggtgc 35923628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 51060382 - 51060282
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| ||||| |||| |||||||  ||||| |||||| |||| || |||||| || | | ||||||||| |||| |||||| ||||||||||||||||||    
51060382 ggttcgattctcagggggaacaacacttggtcagtgcgcatgcctctacgcatgaactggattagtcgtccaccattggtgggtcggaaaccggtgcgaa 51060283  T
170 a 170  Q
    |    
51060282 a 51060282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 70 - 169
Target Start/End: Original strand, 4638160 - 4638259
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||||| ||||| ||||| ||||||| |||  || ||||||||||||| |||||| |  |||||||  || ||||||||||| ||||||    
4638160 ggttcgattcccaggagaaacaacgcttgaccagtgcgcatacctctacgcacgagccggattagtagcccacctttaatgggtcggaaaccgatgcgaa 4638259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 70 - 137
Target Start/End: Original strand, 10855390 - 10855457
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcg 137  Q
    ||||||||| ||||| ||||||| ||||||||||| | |||| || ||||||||| ||||||||||||    
10855390 ggtttgatttccagggggaacaacgcttggccagtacgcatgcctctacgcacgaaccgaattagtcg 10855457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 95 - 170
Target Start/End: Complemental strand, 29762231 - 29762156
Alignment:
95 cttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||||| |||| || || ||| |||| | ||||||||| |||| |||||| |||||||||||||||||||    
29762231 cttggccagtgcgcatgcctctatgcatgagctggattagtcgtccaccattggtgggtcggaaaccggtgcgaaa 29762156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 95 - 170
Target Start/End: Original strand, 54237479 - 54237554
Alignment:
95 cttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||| |||||| ||||||| |||||| |||||| || |||||| |||| || ||| |||||||||||||||||||    
54237479 cttggtcagtgcgcatgtctctacgcatgagccggataagtcgtccaccattagtgggtcggaaaccggtgcgaaa 54237554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 116 - 170
Target Start/End: Original strand, 22909835 - 22909889
Alignment:
116 tacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||| |||||||||||||||| |||||||| || |||||||||| ||||||||    
22909835 tacgcatgagccgaattagtcgtgcacctttgatgggtcggaaaccagtgcgaaa 22909889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 88 - 166
Target Start/End: Complemental strand, 24506731 - 24506653
Alignment:
88 aacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgc 166  Q
    ||||| ||||| |||||||||||| || |||||| ||| |  |||||||| ||||| |||||| |||||||||||||||    
24506731 aacaacgcttgaccagtgcacatgcctctacgcatgagtcagattagtcgctcaccattggtgggtcggaaaccggtgc 24506653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 58 - 171
Target Start/End: Original strand, 49198344 - 49198458
Alignment:
58 ccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcgg 156  Q
    |||| ||||||||| || |||||| ||| |||||||  |||||||||||| |||| || |||||| |||||| ||||||||| |||| ||||||  || |    
49198344 ccggggaataccgggttcgattcctagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtggatcag 49198443  T
157 aaaccggtgcgaaaa 171  Q
    |||||| || |||||    
49198444 aaaccgatgtgaaaa 49198458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 86 - 159
Target Start/End: Original strand, 8164575 - 8164648
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaa 159  Q
    ||||||| ||||||||||||| |||| || |||||||||| || ||||||||  |||||||||||  |||||||    
8164575 ggaacaacgcttggccagtgcgcatgcctttacgcacgagtcggattagtcgcccacctttggtggatcggaaa 8164648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 10043720 - 10043788
Alignment:
102 agtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||| || |||||||||| |  |||| ||| ||||| |||||| |||||||||||||||||||    
10043720 agtgcacatgcctctacgcacgaggcagattaatcgctcaccattggtgggtcggaaaccggtgcgaaa 10043788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 75 - 171
Target Start/End: Complemental strand, 40660423 - 40660327
Alignment:
75 gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaaa 171  Q
    |||||| |||||||||||   |||| |||||| |||| || |||||| || ||| |||| || ||||||||||||| |||| |||||||||| ||||    
40660423 gattcctaggaggaacaacatttggtcagtgcgcatgcctctacgcatgaaccggattaatcattcacctttggtgggtcgaaaaccggtgcaaaaa 40660327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 86 - 170
Target Start/End: Original strand, 49543541 - 49543625
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||| | |||| |||||  |||| || ||||||||||||||||||||||  ||||||| ||| ||||||||| ||| |||||    
49543541 ggaacaacgtttggtcagtgtgcatgcctctacgcacgagccgaattagtcgcccacctttagtgggtcggaaactggtacgaaa 49543625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 54 - 168
Target Start/End: Complemental strand, 26207919 - 26207804
Alignment:
54 gtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgag 152  Q
    |||||||| ||||||||| || |||||||| | ||||||| ||||| ||||||  |||| || |||||| |||||| ||||||||  ||   || ||| |    
26207919 gtacccggggaataccgggttcgattcccacggggaacaacgcttgtccagtgtgcatgcctctacgcatgagccggattagtcggccattattagtggg 26207820  T
153 tcggaaaccggtgcga 168  Q
    ||||||||||||||||    
26207819 tcggaaaccggtgcga 26207804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 95 - 170
Target Start/End: Complemental strand, 43330808 - 43330733
Alignment:
95 cttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| ||||||| |||| || ||||||||||||| ||||||||  ||||||||||| |||  |||||||| |||||    
43330808 cttgaccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcaaaaaccggtacgaaa 43330733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 54 - 160
Target Start/End: Complemental strand, 45402469 - 45402362
Alignment:
54 gtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgag 152  Q
    |||||||| ||||| ||| || |||||| ||  |||||||  || |||| |||| |||| || |||||| |||||| ||||||||||||||||| ||| |    
45402469 gtacccggggaatatcgggttcgattcctagagggaacaacactcggcctgtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtggg 45402370  T
153 tcggaaac 160  Q
    ||||||||    
45402369 tcggaaac 45402362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 81 - 171
Target Start/End: Complemental strand, 34662409 - 34662319
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaaa 171  Q
    ||||||||| || | |||| |||| | ||||||| || ||| |||||||||||||||| ||||||| |||  | |||||||| ||||||||    
34662409 caggaggaataacgtttggtcagtacgcatgtctctatgcatgagccgaattagtcgtccacctttagtggattggaaaccgatgcgaaaa 34662319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 166
Target Start/End: Original strand, 44064596 - 44064646
Alignment:
116 tacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgc 166  Q
    |||||| || ||| |||||||| |||||||||||| |||||||||||||||    
44064596 tacgcatgaaccggattagtcgctcacctttggtgggtcggaaaccggtgc 44064646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 170
Target Start/End: Original strand, 47164158 - 47164212
Alignment:
116 tacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||||||| |||||||| ||| ||||||||  ||||||||||||| ||||    
47164158 tacgcacgagccggattagtcgctcatctttggtggatcggaaaccggtgtgaaa 47164212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 166
Target Start/End: Complemental strand, 50753396 - 50753346
Alignment:
116 tacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgc 166  Q
    |||||||||| || |||||||||||| | |||||| |||||||||||||||    
50753396 tacgcacgagtcggattagtcgttcatcattggtgggtcggaaaccggtgc 50753346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 70 - 171
Target Start/End: Original strand, 6462418 - 6462519
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| ||||| ||||  |||||| ||||||||||||| |||| || |||||| |||||| ||||||||  ||   || ||| || |||||||||||||||    
6462418 ggttcgattcacagggagaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgaccattattagtgggttggaaaccggtgcgaa 6462517  T
170 aa 171  Q
    ||    
6462518 aa 6462519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 169
Target Start/End: Original strand, 8362609 - 8362682
Alignment:
96 ttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    ||||||||| | |||| || |||||| ||||| |||||||||| ||||||| |||  || ||||||||||||||    
8362609 ttggccagtccgcatgcctctacgcatgagccaaattagtcgtccacctttagtggatccgaaaccggtgcgaa 8362682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 47)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 21530757 - 21530857
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    ||||||||||||||| |||||||  ||||| ||||||||||| || |||||||||||||||||| ||| |||||||||||| ||||||||||||| ||||    
21530757 ggtttgattcccagggggaacaacacttggtcagtgcacatgcctctacgcacgagccgaattaatcgctcacctttggtgggtcggaaaccggttcgaa 21530856  T
170 a 170  Q
    |    
21530857 a 21530857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 38578987 - 38578867
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||| ||| || |||||||||| ||||||| ||||||||||||| |||| || |||||| |||||| ||||||||  ||||||||||    
38578987 gacgtacccggggaatatcgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggt 38578888  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
38578887 gggtcggaaaccggtgcgaaa 38578867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 70 - 171
Target Start/End: Complemental strand, 26423387 - 26423287
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| | ||||| ||||||||||||||| || || ||||||||||||  ||||||||||||||||||||| ||||||||||||||||||    
26423387 ggttcgattcccaggggaaacaacgcttggccagtgcacctgcctctacgcacgagccagattagtcgttcacctttggtg-gtcggaaaccggtgcgaa 26423289  T
170 aa 171  Q
    ||    
26423288 aa 26423287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 1605930 - 1606050
Alignment:
51 gacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||||||||||| |||| |||| ||||| ||||||| |||||||||||||||||| || || ||  |||||| ||||||||  ||||||||||    
1605930 gacgtacccggagaatacctggttcgatttccagggggaacaacgcttggccagtgcacatgcctctaggcttgagccggattagtcgcccacctttggt 1606029  T
150 gagtcggaaaccggtgcgaaa 170  Q
    |  ||||||||||||||||||    
1606030 ggatcggaaaccggtgcgaaa 1606050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 51 - 166
Target Start/End: Original strand, 13095847 - 13095963
Alignment:
51 gacgtacccggagaataccggtttg-attcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| ||  ||||||||| |||||||  |||||||||||| |||| || |||||| |||||| |||||||| |||||||||||    
13095847 gacgtacccggggaataccgggttctattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggt 13095946  T
150 gagtcggaaaccggtgc 166  Q
    | |||||||||||||||    
13095947 gggtcggaaaccggtgc 13095963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 14650306 - 14650426
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||||||||| ||| || |||| ||||||||||||||||||| |||||||| ||| || |||||| ||||||  ||||||| |||||||||||    
14650306 gacgtacccggagaatatcgggttcgatttccaggaggaacaatgcttgaccagtgcatatgcctctacgcatgagccgggttagtcgctcacctttggt 14650405  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | || | ||||||||||||||    
14650406 gggttgaaaaccggtgcgaaa 14650426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 22993487 - 22993367
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||| ||| || |||||| ||||||||||| ||||||||||||  |||| || ||||||||| ||| |||||||| |||||||||||    
22993487 gacgtacccggggaatatcgggttcgattccgaggaggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgctcacctttggt 22993388  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||| |||||||||||||||    
22993387 gggtcagaaaccggtgcgaaa 22993367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 47341865 - 47341985
Alignment:
51 gacgtacccggagaataccg-gtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| |||||||| ||| |||||||||| |||||||  |||||||||||| |||| || ||||||||||| | ||| |||||||||| |||||    
47341865 gacgtacccggggaataccgagttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagcaggattggtcgttcaccattggt 47341964  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||| ||||||||||    
47341965 gggtcggaaatcggtgcgaaa 47341985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 42 - 170
Target Start/End: Complemental strand, 43862101 - 43861972
Alignment:
42 ctttgcaaagacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttc 140  Q
    |||| |||||||||| | || ||||||||| || |||||||||| ||||||| | ||||||||||| |||| || |||||| |||||| ||||||| |||    
43862101 ctttccaaagacgtatctggggaataccgggttcgattcccagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtcattc 43862002  T
141 acctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||||  ||| ||||||||||||||    
43862001 acctttggtggatcgaaaaccggtgcgaaa 43861972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 10047996 - 10047876
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || |||||||||| |||||||  |||||||||||| || | || |||||| |||| ||||||||||| |||| |||||    
10047996 gacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcaggcctctacgcatgagcagaattagtcgtccaccattggt 10047897  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
10047896 gggtcggaaaccggtgcgaaa 10047876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 17748482 - 17748382
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| ||||||| ||||||||||||| |||| || |||| |||||||| ||||||||| |||||||| || ||||||||||| ||||||    
17748482 ggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgtacgagccggattagtcgtccacctttgttgggtcggaaaccgatgcgaa 17748383  T
170 a 170  Q
    |    
17748382 a 17748382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 94 - 170
Target Start/End: Original strand, 41945506 - 41945582
Alignment:
94 gcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||||||| |||| || ||||||||||||| ||||||||| |||||||||||||||||||| ||||||||||    
41945506 gcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgagtcggaaatcggtgcgaaa 41945582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 48804672 - 48804792
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || |||||||| | |||||||  |||||||||||| |||| || |||||| |||||| ||||||||| |||| |||||    
48804672 gacgtatccggggaataccgggttcgattcccaaggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggt 48804771  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
48804772 gggtcggaaaccggtgcgaaa 48804792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 51 - 169
Target Start/End: Original strand, 18785658 - 18785777
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||||| ||| |||||||  |||||||||||| |||| || |||||| || | | ||||||||||||||| ||||    
18785658 gacgtacccggggaataccgggttcgattcctagggggaacaacacttggccagtgcgcatgcctctacgcatgaactggattagtcgttcacctctggt 18785757  T
150 gagtcggaaaccggtgcgaa 169  Q
    | ||||||||||||||||||    
18785758 gggtcggaaaccggtgcgaa 18785777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 49 - 171
Target Start/End: Complemental strand, 27875210 - 27875087
Alignment:
49 aagacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttg 147  Q
    |||||||| | || ||||||||| || |||||||||| |||| ||  ||||||||||||||||| || |||||| ||| || ||||||||| |||||||     
27875210 aagacgtatctggggaataccggattcgattcccagggggaataacacttggccagtgcacatgcctctacgcatgagtcgcattagtcgtccaccttta 27875111  T
148 gtgagtcggaaaccggtgcgaaaa 171  Q
    ||| |||| |||||||||||||||    
27875110 gtgggtcgaaaaccggtgcgaaaa 27875087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 54 - 170
Target Start/End: Original strand, 34659218 - 34659335
Alignment:
54 gtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgag 152  Q
    |||||||| ||||||||| || ||||| || | ||||||| ||||| ||||||| |||| || ||||||||||||| ||||||||  |||| |||||| |    
34659218 gtacccggggaataccgggttcgattctcaaggggaacaacgcttgaccagtgcgcatgcctctacgcacgagccggattagtcgcccaccattggtgtg 34659317  T
153 tcggaaaccggtgcgaaa 170  Q
    ||| ||||||||||||||    
34659318 tcgaaaaccggtgcgaaa 34659335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 5069935 - 5069815
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||||||||  |||||||| || |||| ||||||||||||| |||| || ||||  |||| || ||||||| ||||| ||||||||  ||||||||||    
5069935 gacgtacccgggaaataccgggttcgatttccaggaggaacaacgcttagctagtgtgcatgcctctacgcacaagccggattagtcgcccacctttggt 5069836  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||||||||||| |||||||    
5069835 gggtcggaaaccgatgcgaaa 5069815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 86 - 170
Target Start/End: Complemental strand, 8734770 - 8734686
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||||||| |||||| |||| ||  |||||||||||  ||||||||  ||||||||||| |||||||||||||||||||    
8734770 ggaacaatgcttgggcagtgcgcatgcctcaacgcacgagccagattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 8734686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 166
Target Start/End: Original strand, 16802112 - 16802228
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||||  ||||||||||| | |||||||||||  ||| || ||||||||||||| |||||||| ||||| |||||    
16802112 gacgtacccggggaataccggattcgattcttaggaggaacaacgattggccagtgcgtatgcctctacgcacgagccggattagtcgctcaccattggt 16802211  T
150 gagtcggaaaccggtgc 166  Q
    | |||| |||| |||||    
16802212 gggtcgaaaactggtgc 16802228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 27028288 - 27028388
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||| ||||| |||||||  |||||||||||| |||| || ||| || |||| | |||||||| |||||||||||| ||||||||||||||||||    
27028288 ggttcgatttccagggggaacaacacttggccagtgcgcatgcctctacacatgagctggattagtcgctcacctttggtgggtcggaaaccggtgcgaa 27028387  T
170 a 170  Q
    |    
27028388 a 27028388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 162
Target Start/End: Original strand, 42032085 - 42032197
Alignment:
51 gacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||| |||| |||||||| | ||||||| | |||||||||||||||   | |||||| ||||||||||||| || |||||||| |    
42032085 gacgtacccggggaatacctggttcgattcccacggggaacaacgtttggccagtgcacatacatctacgcatgagccgaattagttgtccacctttgat 42032184  T
150 gagtcggaaaccg 162  Q
    | |||||||||||    
42032185 gggtcggaaaccg 42032197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 63 - 171
Target Start/End: Complemental strand, 5039526 - 5039417
Alignment:
63 gaataccg-gtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaacc 161  Q
    |||||||| ||| |||||| |||||||||||  ||||| ||||||||||  || |||||| |||||| |||||||| ||||||||||||  ||| |||||    
5039526 gaataccgagttcgattcctaggaggaacaacacttggtcagtgcacatacctctacgcatgagccggattagtcgctcacctttggtggatcgaaaacc 5039427  T
162 ggtgcgaaaa 171  Q
    ||||| ||||    
5039426 ggtgcaaaaa 5039417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 77 - 170
Target Start/End: Original strand, 28744178 - 28744271
Alignment:
77 ttcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| ||| ||||||||||||||||||| | |||  || |||  |||||||| ||||||||| ||||||||||| ||||||||| |||||||||    
28744178 ttcctagggggaacaatgcttggccagtacgcatacctctacatacgagccggattagtcgtccacctttggtgggtcggaaactggtgcgaaa 28744271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 166
Target Start/End: Original strand, 1797469 - 1797565
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgc 166  Q
    |||| |||||||||| | ||||| ||||||||||||| ||||||| ||||||||||||| | ||||||| || ||||| ||  ||| ||||||||||    
1797469 ggttcgattcccaggggaaacaacgcttggccagtgcgcatgtctctacgcacgagccggactagtcgtccatctttgatggatcgaaaaccggtgc 1797565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 22973956 - 22974076
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||| ||| ||||||||| || ||||| |||| ||||||| ||||||||||||  ||||  | |||||| |||||  ||||||||| ||||||||||    
22973956 gacgtactcggggaataccgggttcgattctcagggggaacaacgcttggccagtgtgcatgcgtctacgcatgagccagattagtcgtccacctttggt 22974055  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||| |||||||| ||||||    
22974056 gggtcagaaaccggcgcgaaa 22974076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 86 - 170
Target Start/End: Original strand, 37514946 - 37515030
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||| | |||| |||||| ||||||| ||||||||||||| |||| ||||||||| || ||| |||||||||||||| ||||    
37514946 ggaacaacgtttggtcagtgcgcatgtctctacgcacgagccggattaatcgttcaccattagtgggtcggaaaccggtgtgaaa 37515030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 54 - 166
Target Start/End: Original strand, 39420830 - 39420942
Alignment:
54 gtacccggagaataccggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagt 153  Q
    |||||||| ||||||||||| || |||||   ||||||| ||||||||||||| | || || |||||| |||||| |||||||||  ||||||| || |     
39420830 gtacccggggaataccggttcgaatcccaaagggaacaacgcttggccagtgcgcgtgcctctacgcatgagccggattagtcgtctacctttgatgggc 39420929  T
154 cggaaaccggtgc 166  Q
    |||||||||||||    
39420930 cggaaaccggtgc 39420942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 96 - 170
Target Start/End: Original strand, 3353459 - 3353533
Alignment:
96 ttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||||| |||| || ||||||||||||| ||||||||| |||||||| ||  || |||||||||||||||    
3353459 ttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttgatggatcagaaaccggtgcgaaa 3353533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 101 - 170
Target Start/End: Original strand, 3603397 - 3603466
Alignment:
101 cagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||| |||| || ||||||||||||| |||| |||||||| ||||||| |||||||| ||||||||||    
3603397 cagtgcgcatgcctctacgcacgagccggattaatcgttcacttttggtgggtcggaaatcggtgcgaaa 3603466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 4195322 - 4195202
Alignment:
51 gacgtacccggagaataccg-gtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| |||||||| ||| |||| |||||||||||||   ||||| ||||| |||| || |||||| |||||| ||||| ||| |||| |||||    
4195322 gacgtatccggggaataccgagttcgatttccaggaggaacaacatttggctagtgcgcatgcctctacgcatgagccggattagccgtccaccattggt 4195223  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | || |||||||| |||||||    
4195222 gggttggaaaccgatgcgaaa 4195202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 51 - 166
Target Start/End: Original strand, 23658168 - 23658284
Alignment:
51 gacgtacccggagaata-ccggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||| | ||||| || ||| |||| ||||| ||||||| ||||||||||||  |||| || ||| ||||||||| ||||||||| || |||||||    
23658168 gacgtacccagggaatatccagttcgatttccagggggaacaacgcttggccagtgtgcatgcctctacacacgagccggattagtcgtccatctttggt 23658267  T
150 gagtcggaaaccggtgc 166  Q
    | ||| |||||| ||||    
23658268 gggtcagaaacctgtgc 23658284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 86 - 170
Target Start/End: Complemental strand, 29805524 - 29805440
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||| | |||| |||||| ||||||| |||||| ||||| ||||| ||||  |||||| |||||||||||||| ||||||||    
29805524 ggaacaacgtttggtcagtgcgcatgtctctacgcatgagccaaattaatcgtctacctttagtgagtcggaaaccagtgcgaaa 29805440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 49142769 - 49142669
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||| ||| ||||||| |||| ||||||||||||| || ||||||||||||| |||||| |  |||||||| || |||| |||  ||||||||    
49142769 ggttcgattcctagggggaacaacgcttagccagtgcacatgcctctacgcacgagccggattagttgcccacctttgatgggtcgaaaattggtgcgaa 49142670  T
170 a 170  Q
    |    
49142669 a 49142669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 170
Target Start/End: Original strand, 32768983 - 32769046
Alignment:
107 acatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||| || |||||||||| || |||||||||||||||||||||  ||||||||||||| ||||    
32768983 acatgcctctacgcacgagtcggattagtcgttcacctttggtggatcggaaaccggtgtgaaa 32769046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 51 - 147
Target Start/End: Original strand, 43925501 - 43925598
Alignment:
51 gacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttg 147  Q
    ||||||||||| ||||||| |||| |||||||||| |||||||  ||||| |||||| |||| || |||||| |||| | |||||| ||| |||||||    
43925501 gacgtacccggggaataccgggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctggattagttgtttacctttg 43925598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 76 - 164
Target Start/End: Complemental strand, 28396254 - 28396166
Alignment:
76 attcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggt 164  Q
    |||| |||| ||||||| |||| ||  |||| |||| || |||||| |||||| |||||||||  |||||||||| |||||||||||||    
28396254 attctcagggggaacaacgcttagctggtgcgcatgcctttacgcatgagccggattagtcgtctacctttggtgggtcggaaaccggt 28396166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 166
Target Start/End: Complemental strand, 45960111 - 45960007
Alignment:
63 gaataccg-gtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaacc 161  Q
    |||||||| |||||||||||| | | |||||  ||||| |||||| |||| || ||||||  ||||| |||||||| ||||||||| ||  |||||||||    
45960111 gaataccgagtttgattcccaagggcaacaacacttggtcagtgcgcatgcctctacgcataagccggattagtcgctcacctttgatggatcggaaacc 45960012  T
162 ggtgc 166  Q
    |||||    
45960011 ggtgc 45960007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 86 - 170
Target Start/End: Complemental strand, 48244440 - 48244356
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||||||  ||||||   || || |||||| |||||| |||||||| ||||||||||||  ||| ||||||||||||||    
48244440 ggaacaatgcttgatcagtgcgtttgcctctacgcatgagccggattagtcgctcacctttggtggatcgaaaaccggtgcgaaa 48244356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 52 - 170
Target Start/End: Complemental strand, 10317864 - 10317746
Alignment:
52 acgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtg 150  Q
    |||||||||| ||||||||| || |||||||||| |||| ||  ||||| ||||||  ||| || || |||  ||| || ||||||| ||||||||||||    
10317864 acgtacccggggaataccgggttcgattcccagggggaataacacttggtcagtgcgtatgcctctatgcataagcaga-ttagtcgctcacctttggtg 10317766  T
151 agtcggaaaccggtgcgaaa 170  Q
      ||||||||||||||||||    
10317765 gatcggaaaccggtgcgaaa 10317746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 87 - 170
Target Start/End: Original strand, 48551883 - 48551966
Alignment:
87 gaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||| | ||||||| ||| |||| || |||| | |||||| ||||||||| |||||||| ||  ||||||||||||||||||    
48551883 gaacaacggttggccaatgcgcatgcctctacgtatgagccggattagtcgtccacctttgatggatcggaaaccggtgcgaaa 48551966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 170
Target Start/End: Original strand, 32823246 - 32823352
Alignment:
64 aataccggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccgg 163  Q
    |||||| ||| |||||||||| |||||||  ||||||| |||   ||| || ||||||||||||| ||||||||   ||| ||| || ||||||||| ||    
32823246 aataccagttcgattcccagggggaacaacacttggccggtgtgtatgcctctacgcacgagccggattagtcgcagaccattgatgggtcggaaacggg 32823345  T
164 tgcgaaa 170  Q
    |||||||    
32823346 tgcgaaa 32823352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 96 - 170
Target Start/End: Complemental strand, 42210336 - 42210262
Alignment:
96 ttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||||| |||| || ||||||||||||| |||| ||   |||| |||||| ||||||||||| |||||||    
42210336 ttggccagtgcgcatgcctctacgcacgagccggattaatcacccaccgttggtgggtcggaaaccgatgcgaaa 42210262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 58 - 170
Target Start/End: Complemental strand, 21190893 - 21190780
Alignment:
58 ccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcgg 156  Q
    |||| ||||||||| || |||||| ||||||| ||| ||||||| ||||| |||| || |||||||||| |  ||||||||  || |  ||||| ||||     
21190893 ccggggaataccgggttcgattcctaggaggagcaacgcttggctagtgcgcatgcctctacgcacgagtcagattagtcgcccatcaatggtgggtcga 21190794  T
157 aaaccggtgcgaaa 170  Q
    ||||||||||||||    
21190793 aaaccggtgcgaaa 21190780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 170
Target Start/End: Complemental strand, 34127698 - 34127645
Alignment:
117 acgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||||| ||||||||  ||||||||||| |||  ||||||||||||||    
34127698 acgcacgagccggattagtcgcccacctttggtgggtcaaaaaccggtgcgaaa 34127645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 95 - 168
Target Start/End: Original strand, 38988934 - 38989006
Alignment:
95 cttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcga 168  Q
    ||||| ||||||||||| || |||||| || ||| |||||||| ||| |||||||| ||| |||||||||||||    
38988934 cttggtcagtgcacatgcctctacgcatgaaccggattagtcgctcatctttggtgggtc-gaaaccggtgcga 38989006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 170
Target Start/End: Complemental strand, 22268081 - 22268041
Alignment:
130 attagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||| ||||||||||||  ||||||||||||||||||    
22268081 attagtcgctcacctttggtggatcggaaaccggtgcgaaa 22268041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 29151949 - 29152049
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| ||||||||||| |||||| | ||| ||||||| |||| || ||| ||||| ||| |||| ||||  ||| ||| || ||||||||||| ||||||    
29151949 ggttcgattcccaggaagaacaacgtttgaccagtgcgcatgcctctacacacgatccggattaatcgtctaccattgatgggtcggaaaccgatgcgaa 29152048  T
170 a 170  Q
    |    
29152049 a 29152049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0291 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0291
Description:

Target: scaffold0291; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 56 - 170
Target Start/End: Original strand, 6849 - 6964
Alignment:
56 acccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtc 154  Q
    |||||| ||||||||| || |||||||||| |||||||  |||||||||||| |||| || |||||| |||||| |||||||| |||||||||||| |||    
6849 acccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtc 6948  T
155 ggaaaccggtgcgaaa 170  Q
    ||||||||||||||||    
6949 ggaaaccggtgcgaaa 6964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 52)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 5855529 - 5855629
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||||||||||| ||||||||||||| |||| || |||||| ||| || ||||||||||||||||| ||| ||||||||||| ||||||    
5855529 ggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgaggcggattagtcgttcacctttagtgggtcggaaaccgatgcgaa 5855628  T
170 a 170  Q
    |    
5855629 a 5855629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 8763978 - 8764098
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||| ||| || | |||||||| |||||||  |||||||||||| |||| || ||||||||||||| ||||||||| |||| |||||    
8763978 gacgtacccggggaatatcgggttcgtttcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgtccaccgttggt 8764077  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
8764078 gggtcggaaaccggtgcgaaa 8764098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 17642105 - 17642005
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| |||||||  |||||||||||| |||| || ||||||||||||| ||||||||| ||||||||||| ||||||||| ||||||||    
17642105 ggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcggaaactggtgcgaa 17642006  T
170 a 170  Q
    |    
17642005 a 17642005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 18915854 - 18915974
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || |||||||||| |||||||  |||||||||||  |||| || ||||||||||||| |||||||| ||||| |||||    
18915854 gacgtacccggggaataccgggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcgctcaccattggt 18915953  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | || ||||||||||||||||    
18915954 gggttggaaaccggtgcgaaa 18915974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 45362003 - 45361883
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||| | ||||||||| || ||||| |||||||||||| ||||||||||||| |||| |  ||||||  ||||| ||||||||||||||||| ||    
45362003 gacgtaccctgggaataccgggttcgattctcaggaggaacaacgcttggccagtgcgcatgccactacgcataagccggattagtcgttcacctttagt 45361904  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
45361903 gggtcggaaaccggtgcgaaa 45361883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 47 - 161
Target Start/End: Complemental strand, 33418240 - 33418125
Alignment:
47 caaagacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctt 145  Q
    ||||||||||||||||||||||||| || |||||| ||| || |||| ||||||||||||| |||| || || |||||||||| ||||||||| ||||||    
33418240 caaagacgtacccggagaataccggattcgattcctaggggggacaacgcttggccagtgcgcatgcctctatgcacgagccggattagtcgtccacctt 33418141  T
146 tggtgagtcggaaacc 161  Q
    ||||  ||||||||||    
33418140 tggtcggtcggaaacc 33418125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 82 - 170
Target Start/End: Original strand, 10422807 - 10422895
Alignment:
82 aggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||||  |||||||||||| |||| || |||||| |||||| ||||||||| |||||||||| ||||||||||||||||||||    
10422807 aggaggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtaagtcggaaaccggtgcgaaa 10422895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 43959942 - 43959822
Alignment:
51 gacgtacccggagaataccggtttga-ttcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||| ||| || | |||||||| ||||||| ||||||||||||| |||| || ||||||||||||| ||||||||  ||||||| ||    
43959942 gacgtacccggggaatatcgggttcaattcccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttagt 43959843  T
150 gagtcggaaaccggtgcgaaa 170  Q
    |  ||||||||||||||||||    
43959842 ggatcggaaaccggtgcgaaa 43959822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 49078101 - 49078221
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || |||||||||| | |||||  |||||||||||| |||| || |||||| |||||| |||||||||||||| |||||    
49078101 gacgtatccggggaataccgggttcgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccattggt 49078200  T
150 gagtcggaaaccggtgcgaaa 170  Q
      |||||||||||||||||||    
49078201 aggtcggaaaccggtgcgaaa 49078221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 41663977 - 41663857
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| || |||||||||| |||||||  ||||| |||||| |||| || |||||| |||| | ||||||||| |||| |||||    
41663977 gacgtatccggggaataccgggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctggattagtcgtccaccattggt 41663878  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
41663877 gggtcggaaaccggtgcgaaa 41663857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 95 - 170
Target Start/End: Complemental strand, 4581758 - 4581683
Alignment:
95 cttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||||| |||| || ||||||||||||| | ||||||| ||||||||||| |||||||||||||||||||    
4581758 cttggccagtgcgcatgcctctacgcacgagccggaatagtcgtccacctttggtgggtcggaaaccggtgcgaaa 4581683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 54 - 170
Target Start/End: Original strand, 37339809 - 37339927
Alignment:
54 gtacccggagaataccggttt-gattcccaggagga-acaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtga 151  Q
    |||||||| ||||||||| || |||||||||| ||  |||| ||||||||||||| |||| ||  |||||||||||| ||||||||  |||||||||||     
37339809 gtacccggggaataccgggttcgattcccagggggggacaacgcttggccagtgcgcatgcctcaacgcacgagccggattagtcgcccacctttggtgg 37339908  T
152 gtcggaaaccggtgcgaaa 170  Q
    || ||||||||||||||||    
37339909 gttggaaaccggtgcgaaa 37339927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 70 - 159
Target Start/End: Complemental strand, 12036845 - 12036756
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaa 159  Q
    ||||||||||| ||| ||||||||||||||||||||| |||| || ||||||||||||  |||| |||| |||||||||||  |||||||    
12036845 ggtttgattcctagggggaacaatgcttggccagtgcgcatgcctctacgcacgagccagattaatcgtccacctttggtggatcggaaa 12036756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 81 - 170
Target Start/End: Complemental strand, 32142936 - 32142847
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| |||||||  |||||||||||| |||| || |||||| ||||||||||||||| ||||||||| || ||||||||||| |||||||    
32142936 cagggggaacaacacttggccagtgcgcatgcctttacgcatgagccgaattagtcgctcacctttgatgggtcggaaaccgatgcgaaa 32142847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 9659299 - 9659180
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||| ||| ||||||||| || |||||||||| ||||||| | ||| | ||||| |||| || |||||| |||||| ||||||||| ||||||||||    
9659299 gacgtactcggggaataccgggttcgattcccagg-ggaacaacgtttgactagtgcgcatgcctttacgcatgagccggattagtcgtccacctttggt 9659201  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | || ||||||||||||||||    
9659200 gggttggaaaccggtgcgaaa 9659180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 16956453 - 16956573
Alignment:
51 gacgtacccggagaataccg-gtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| |||||||| ||| | ||| |||| | ||||| | ||| ||||||| |||| || ||||||||||||| |||||||  |||||||||||    
16956453 gacgtacccggggaataccgtgttcggttctcaggggtaacaacgtttgaccagtgcgcatgcctctacgcacgagccggattagtcactcacctttggt 16956552  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||| ||||||||    
16956553 gggtcggaaaccagtgcgaaa 16956573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 26325819 - 26325919
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||  |||||||  ||||| |||||| |||| || |||||| |||||| ||||||||| |||| |||||| ||||||||||||||||||    
26325819 ggttcgattcccagcgggaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaa 26325918  T
170 a 170  Q
    |    
26325919 a 26325919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 35211273 - 35211173
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||| |||| ||||||||||||| |||| | | |||| || |||||| |||| ||||||||||| ||||||||||| |||||||||||||| |||    
35211273 ggttcgatttccagaaggaacaatgcttagccaatacgcatgcctctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgtgaa 35211174  T
170 a 170  Q
    |    
35211173 a 35211173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 45726554 - 45726434
Alignment:
51 gacgtacccggagaatacc-ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||  ||||||| |||| ||||| ||||||||| ||   |||||||||||  |||||| |||||| |||||| ||||||||||||||||||||    
45726554 gacgtacccgaggaatacctggttcgattctcaggaggaataacatttggccagtgcgtatgtctctacgcatgagccggattagtcgttcacctttggt 45726455  T
150 gagtcggaaaccggtgcgaaa 170  Q
    |  ||||| || |||||||||    
45726454 ggatcggagactggtgcgaaa 45726434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 75 - 138
Target Start/End: Original strand, 32883 - 32946
Alignment:
75 gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgt 138  Q
    |||||||||||||||||| |||||| ||||||||||| || |||||| ||||||||||||||||    
32883 gattcccaggaggaacaacgcttggtcagtgcacatgcctctacgcatgagccgaattagtcgt 32946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 87 - 170
Target Start/End: Complemental strand, 10173055 - 10172972
Alignment:
87 gaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||| ||||||||||||| |||| || |||||| |||||| |||| |||  ||||||||||| |||||||||||||||||||    
10173055 gaacaacgcttggccagtgcccatgcctctacgcatgagccggattactcgcccacctttggtgggtcggaaaccggtgcgaaa 10172972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 162
Target Start/End: Original strand, 15465972 - 15466064
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccg 162  Q
    |||| |||| ||||| ||||||| |||||| ||||||||||| || |||||||||| |  ||| |||| |||||||||||| |||||||||||    
15465972 ggttcgatttccagggggaacaacgcttggtcagtgcacatgcctctacgcacgagtctgattggtcgctcacctttggtgggtcggaaaccg 15466064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 16263552 - 16263652
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||| ||||||||||||| ||||||||||||| |||| || ||||||  ||||| | ||||||| ||| |||| ||  |||||||||||||||||    
16263552 ggttcgatttccaggaggaacaacgcttggccagtgcgcatgcctctacgcataagccggaatagtcgtccacttttgatggatcggaaaccggtgcgaa 16263651  T
170 a 170  Q
    |    
16263652 a 16263652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 21849305 - 21849206
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| ||||||| ||||||| ||||| |||| || ||||||||||||| |||||||| ||||  |||||| |||| |||||||| ||||    
21849305 ggttcgattcccagg-ggaacaacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgctcactattggtgggtcgaaaaccggtacgaa 21849207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 33004136 - 33004016
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||| ||| || |||| ||||| | ||||||||||||||||||| |||| || ||||||||||||| |||||||   ||||  ||||    
33004136 gacgtatccggggaatatcggattcgatttccaggggaaacaatgcttggccagtgcgcatgcctctacgcacgagccggattagtcacccaccaatggt 33004037  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||| ||||||||||||||    
33004036 gggtcgaaaaccggtgcgaaa 33004016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 54 - 127
Target Start/End: Original strand, 6563431 - 6563505
Alignment:
54 gtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagcc 127  Q
    ||||||| |||| ||||| || |||||| ||| ||||||| ||||||||||||||||||||| ||||||||||||    
6563431 gtacccgaagaacaccgggttcgattcctagggggaacaacgcttggccagtgcacatgtctctacgcacgagcc 6563505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 54 - 147
Target Start/End: Complemental strand, 33498957 - 33498863
Alignment:
54 gtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttg 147  Q
    ||||| ||| |||||||| || ||||| |||||||| ||| ||||||||||||| |||| || |||||| |||||| ||||||||| ||||||||    
33498957 gtacctggaaaataccgggttcgattctcaggaggagcaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttg 33498863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 58 - 170
Target Start/End: Complemental strand, 11398002 - 11397890
Alignment:
58 ccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcgg 156  Q
    |||||||||||||| || |||||| ||| ||||||| | ||||||| |||  ||| || |||||| ||| || ||||||||| ||||||||||| |||||    
11398002 ccggagaataccgggttcgattccgagg-ggaacaacgtttggccaatgcgtatgcctctacgcatgagtcggattagtcgtccacctttggtgggtcgg 11397904  T
157 aaaccggtgcgaaa 170  Q
    ||| ||||||||||    
11397903 aaatcggtgcgaaa 11397890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 5504070 - 5504138
Alignment:
102 agtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||| || |||||| |||||| ||||||||| |||||||| || ||||||||||||| |||||    
5504070 agtgcacatgcctctacgcatgagccggattagtcgtccacctttgatgggtcggaaaccggtacgaaa 5504138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 81 - 161
Target Start/End: Complemental strand, 14254358 - 14254278
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaacc 161  Q
    |||| ||||||| ||||||||||| | |||| || |||||| |||||| ||||||||| |||||||| || ||||||||||    
14254358 cagggggaacaacgcttggccagtacgcatgcctttacgcatgagccggattagtcgtccacctttgatgggtcggaaacc 14254278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 47 - 166
Target Start/End: Original strand, 26258679 - 26258798
Alignment:
47 caaagacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctt 145  Q
    ||||||||||||||| ||||||||| || ||||| ||||| || ||| |||||| ||||||||||| || |||||| ||| || |||| |||| ||||||    
26258679 caaagacgtacccggggaataccggattcgattctcaggaaga-caacgcttggtcagtgcacatgcctttacgcatgagtcggattaatcgtccacctt 26258777  T
146 tggtgagtcggaaaccggtgc 166  Q
    | ||| || |||||| |||||    
26258778 tagtgggttggaaactggtgc 26258798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 32151023 - 32150923
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||| ||||| |||||||   |||| |||||| |||| || |||||| ||||||||||||||| ||||||||| || |||| |||||| ||||||    
32151023 ggttcgatttccagggggaacaacatttggtcagtgcgcatgcctttacgcatgagccgaattagtcgctcacctttgatgggtcgaaaaccgatgcgaa 32150924  T
170 a 170  Q
    |    
32150923 a 32150923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 94 - 170
Target Start/End: Original strand, 34719807 - 34719883
Alignment:
94 gcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||| ||||||| |||| || |||||||||| |  |||||||| |||||||||||| ||||||||| |||||||||    
34719807 gcttgaccagtgcgcatgcctctacgcacgagtcagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 34719883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 50503462 - 50503362
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| |||||||  |||| ||||||| |||| || ||||||||||||| ||| ||||  ||||  ||||| ||||||||||| ||||||    
50503462 ggttcgattcccagggggaacaacacttgaccagtgcgcatgcctctacgcacgagccggatttgtcgcccaccaatggtgggtcggaaaccgatgcgaa 50503363  T
170 a 170  Q
    |    
50503362 a 50503362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 81 - 170
Target Start/End: Complemental strand, 12744613 - 12744524
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| ||||||| ||||| | ||||| ||||||| |||||| ||||||||||||||| ||||  |||||| ||| ||||| | |||||||    
12744613 cagggggaacaacgcttgactagtgcgcatgtctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagatgcgaaa 12744524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 81 - 170
Target Start/End: Complemental strand, 12755603 - 12755514
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| ||||||| ||||| | ||||| ||||||| |||||| ||||||||||||||| ||||  |||||| ||| ||||| | |||||||    
12755603 cagggggaacaacgcttgactagtgcgcatgtctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagatgcgaaa 12755514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 81 - 170
Target Start/End: Complemental strand, 50371924 - 50371835
Alignment:
81 caggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||| |||||| ||||||||||| | ||||  | ||||||| ||||| ||||||||  || ||||||||  ||||||||||||||||||    
50371924 caggaagaacaacgcttggccagtacgcatgcttctacgcacaagccggattagtcgcccatctttggtggatcggaaaccggtgcgaaa 50371835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 2981032 - 2980932
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||  |||||||  |||||||||||  |||| || |||||||||| || ||||||||| ||  ||| ||| |||||||| |||||||||    
2981032 ggttcgattcccagcgggaacaacacttggccagtgtgcatgcctctacgcacgagtcggattagtcgtccatgtttagtgggtcggaaatcggtgcgaa 2980933  T
170 a 170  Q
    |    
2980932 a 2980932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 15238207 - 15238107
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| ||| ||| ||||||||| ||  |||| || |||||||||  |  |||||||| |||||||||||| || |||||||||| ||||    
15238207 ggttcgattcccagggggagcaacgcttggccaatgagcatgcctctacgcacgaatcatattagtcgctcacctttggtgggttggaaaccggttcgaa 15238108  T
170 a 170  Q
    |    
15238107 a 15238107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 86 - 166
Target Start/End: Complemental strand, 30927812 - 30927732
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgc 166  Q
    ||||||| ||||||||| ||  |||| || |||||| |||||| ||||||||| ||| ||||||| ||| |||||||||||    
30927812 ggaacaacgcttggccaatgtgcatgcctctacgcatgagccggattagtcgtccacttttggtgggtcagaaaccggtgc 30927732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 122
Target Start/End: Original strand, 45536695 - 45536767
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcac 122  Q
    ||||||||||||||||||||| || |||| | | | ||||||| |||||||||||||||||| || |||||||    
45536695 gacgtacccggagaataccgggttcgatttctaaggggaacaacgcttggccagtgcacatgcctctacgcac 45536767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 118 - 170
Target Start/End: Original strand, 51437512 - 51437564
Alignment:
118 cgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| |||||| ||||||| | ||||||||||| |||||||||||||||||||    
51437512 cgcatgagccggattagtcatccacctttggtgggtcggaaaccggtgcgaaa 51437564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 84 - 159
Target Start/End: Original strand, 48761197 - 48761272
Alignment:
84 gaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaa 159  Q
    ||||||||| | |||| ||||| ||||| || ||||||||||| | ||||||||| ||||||||||  ||||||||    
48761197 gaggaacaacgtttggtcagtggacatgcctctacgcacgagctggattagtcgtccacctttggtcggtcggaaa 48761272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 88 - 170
Target Start/End: Original strand, 2567301 - 2567383
Alignment:
88 aacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||| ||||||||||||| |||| || ||| |||||| |  ||||| ||| || |||||||| ||||||||||||| |||||    
2567301 aacaacgcttggccagtgcgcatgcctctactcacgagtcagattagccgtccatctttggtgggtcggaaaccggtacgaaa 2567383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 161
Target Start/End: Original strand, 10507714 - 10507796
Alignment:
79 cccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaacc 161  Q
    |||||||||||||| | ||||||||||  |||  || |||||| |||||| ||||||||| ||||  ||||| ||||||||||    
10507714 cccaggaggaacaacgtttggccagtgtgcatacctctacgcatgagccggattagtcgtccaccactggtgggtcggaaacc 10507796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 170
Target Start/End: Original strand, 14357792 - 14357862
Alignment:
100 ccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||| |||| || ||||||||| ||| |||| ||||| ||| ||| || |||||||||||||||||||    
14357792 ccagtgcgcatgcctctacgcacgaaccggattaatcgtttaccattgatgggtcggaaaccggtgcgaaa 14357862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 96 - 170
Target Start/End: Original strand, 19195399 - 19195468
Alignment:
96 ttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||||| |||| || |||||| |||||||     |||| |||||||| ||||||||||||||||||||||    
19195399 ttggccagtgcgcatgcctctacgcatgagccga-----tcgtccacctttgatgagtcggaaaccggtgcgaaa 19195468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 170
Target Start/End: Original strand, 26660191 - 26660244
Alignment:
116 tacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||| |||||| ||||||||  ||||||||||| |||||||||||||||||||    
26660191 tacgcatgagccggattagtcgc-cacctttggtgggtcggaaaccggtgcgaaa 26660244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 6899597 - 6899665
Alignment:
102 agtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||| |||| || ||||||| ||||| ||||||||  |||||||| ||  ||||||||||||||||||    
6899597 agtgcgcatgcctttacgcacaagccggattagtcgcccacctttgatggatcggaaaccggtgcgaaa 6899665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 168
Target Start/End: Complemental strand, 17092532 - 17092480
Alignment:
116 tacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcga 168  Q
    ||||||||||||| ||||||||| ||||||||||   || |||||||||||||    
17092532 tacgcacgagccggattagtcgtccacctttggtagatcagaaaccggtgcga 17092480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 166
Target Start/End: Complemental strand, 31576648 - 31576552
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgc 166  Q
    |||| ||||| |||| | ||||||||||||||| |||   || || |||||| ||||||  |||||||| || ||||| || |||||||||||||||    
31576648 ggttcgattctcaggggaaacaatgcttggccaatgcgtgtgcctctacgcatgagccggcttagtcgtccatctttgatgtgtcggaaaccggtgc 31576552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 44969672 - 44969771
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| ||||| |||||| ||||| ||||||||||||  |||| |  |||||| |||||| ||||||||| || | ||||||  ||||||||||||| |||    
44969672 ggttcgattctcaggag-aacaacgcttggccagtgtgcatgcccctacgcatgagccggattagtcgtccatcattggtggatcggaaaccggtgtgaa 44969770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: scaffold0010
Description:

Target: scaffold0010; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 75 - 170
Target Start/End: Complemental strand, 155806 - 155711
Alignment:
75 gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||||| ||||||| ||||||| ||||| |||| || ||||||||||||| ||||||||  ||||||||||| ||||||| |||||||||||    
155806 gattcccagggggaacaacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaagccggtgcgaaa 155711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 8801 - 8701
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||||||| ||||||| ||||||||||||| | || || |||||| |||| | ||||||||| ||||||||||| ||||||||| ||||||||    
8801 ggttcgattcccagggggaacaacgcttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaactggtgcgaa 8702  T
170 a 170  Q
    |    
8701 a 8701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0170 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold0170
Description:

Target: scaffold0170; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 63 - 161
Target Start/End: Original strand, 9846 - 9945
Alignment:
63 gaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaacc 161  Q
    ||||||||| || |||| ||||| ||||||| ||||||||||||| |||| || ||||||||||||| ||||||||| ||||||||||| ||| ||||||    
9846 gaataccggattcgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcagaaacc 9945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0376 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: scaffold0376
Description:

Target: scaffold0376; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 12659 - 12779
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||| ||||| ||||||||| || |||||  ||||||||||| ||||||||||||  |||| || ||||||||| ||| ||||||||  |||||||| |    
12659 gacgtgcccggggaataccgggttcgattcagaggaggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgcccacctttgat 12758  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | ||| |||||||||||||||    
12759 gggtcagaaaccggtgcgaaa 12779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0086 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: scaffold0086
Description:

Target: scaffold0086; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 70 - 170
Target Start/End: Original strand, 26192 - 26292
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||| ||||| ||||||| ||||||||||||  |||| || ||||||||||||| ||||||||| |||  ||| ||||||||||||| |||||||    
26192 ggttcgatttccagggggaacaacgcttggccagtgtgcatgcctctacgcacgagccggattagtcgtccacaattgatgagtcggaaaccagtgcgaa 26291  T
170 a 170  Q
    |    
26292 a 26292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 42932 - 42832
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||||| |||  ||||||||||||| |||||| |||| || ||| || |||||| ||||||||  ||||||||||| ||||||||||||||||||    
42932 ggttcgattcctagggagaacaatgcttggtcagtgcgcatgcctctacacatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaa 42833  T
170 a 170  Q
    |    
42832 a 42832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 116 - 173
Target Start/End: Original strand, 9497 - 9554
Alignment:
116 tacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaaagc 173  Q
    |||||| ||||| |||||||||| ||||||||||| ||| ||||||||||||||||||    
9497 tacgcatgagccaaattagtcgtccacctttggtgggtcagaaaccggtgcgaaaagc 9554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 319411 - 319531
Alignment:
51 gacgtacccggagaataccgg-tttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    |||||| |||| ||||||||| ||||||| | ||| ||||||| ||||||||||||| |||  || || ||| |||| | ||||||||| ||||||||||    
319411 gacgtatccggggaataccgggtttgatttctagggggaacaacgcttggccagtgcgcatccctctatgcatgagctggattagtcgtccacctttggt 319510  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | | |||||||||||||||||    
319511 ggggcggaaaccggtgcgaaa 319531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 51 - 170
Target Start/End: Original strand, 559 - 679
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| || ||||| |||| |||||||  ||||  |||||  |||| || |||| | |||||  |||||||| |||||||||||    
559 gacgtacccggggaataccgggttcgattcgcagggggaacaacacttgatcagtgtgcatgcctctacgtatgagccagattagtcgctcacctttggt 658  T
150 gagtcggaaaccggtgcgaaa 170  Q
    | |||||||||||||||||||    
659 gggtcggaaaccggtgcgaaa 679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 91 - 170
Target Start/End: Original strand, 186547 - 186626
Alignment:
91 aatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||| |||| ||||||||||| || ||||||||||||| |||||||||||| |||| ||| |||||||||||||| ||||    
186547 aatgtttggtcagtgcacatgcctctacgcacgagccggattagtcgttcatctttagtgggtcggaaaccggtgtgaaa 186626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 101 - 170
Target Start/End: Original strand, 224357 - 224426
Alignment:
101 cagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||||  || ||||||||||||| ||||||||| || |||||||| |||||||||||||||||||    
224357 cagtgcacatacctctacgcacgagccggattagtcgtccatctttggtgggtcggaaaccggtgcgaaa 224426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 51 - 137
Target Start/End: Complemental strand, 271194 - 271107
Alignment:
51 gacgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcg 137  Q
    ||||||||||||||||| ||| || |||||||||| ||||||| |||||| |||||| ||||||| |||||||||||||  |||||||    
271194 gacgtacccggagaatatcgggttcgattcccagggggaacaacgcttggtcagtgcgcatgtctctacgcacgagccgggttagtcg 271107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 96 - 170
Target Start/End: Complemental strand, 250099 - 250025
Alignment:
96 ttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||||| |||| || ||||||||||||| |||||||| || ||||||||| |||||||| ||||||||||    
250099 ttggccagtgcgcatgcctctacgcacgagccggattagtcgctcgcctttggtgggtcggaaatcggtgcgaaa 250025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0384 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0384
Description:

Target: scaffold0384; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 53 - 162
Target Start/End: Original strand, 5964 - 6073
Alignment:
53 cgtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtga 151  Q
    ||||||||| |||||| || || |||| ||||| ||| ||| |||||||||||||||||| || |||||| ||| |||||||||||| |||| ||||||     
5964 cgtacccggggaatactgggttcgatttccaggggga-caacgcttggccagtgcacatgcctctacgcatgagacgaattagtcgtccaccattggtgg 6062  T
152 gtcggaaaccg 162  Q
    |||||||||||    
6063 gtcggaaaccg 6073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0316 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0316
Description:

Target: scaffold0316; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 170
Target Start/End: Complemental strand, 1714 - 1614
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaa 169  Q
    |||| |||| ||||| ||||||| | || |||||||| |||| || |||||| ||||| |||||||||  ||||||||||| |||| |||||||||||||    
1714 ggttcgatttccagggggaacaacgattagccagtgcgcatgcctctacgcatgagccaaattagtcgcccacctttggtgggtcgaaaaccggtgcgaa 1615  T
170 a 170  Q
    |    
1614 a 1614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 70 - 168
Target Start/End: Original strand, 68526 - 68621
Alignment:
70 ggtttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcga 168  Q
    |||| |||||||||| ||||||| ||||||   |||| |||| || ||||||||||||| ||||||||  ||||||||||| |||| ||||||||||||    
68526 ggttcgattcccagggggaacaacgcttgg---gtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcga 68621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 51 - 170
Target Start/End: Complemental strand, 7955 - 7835
Alignment:
51 gacgtacccggagaataccgg-tttgattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggt 149  Q
    ||||||||||| ||||||||| ||||||||||| | |||| ||  |||||||||||| |||| || ||||||  ||| | ||||||||  ||||||||||    
7955 gacgtacccggggaataccgggtttgattcccaaggggaaaaacacttggccagtgcgcatgcctctacgcattagctggattagtcgcccacctttggt 7856  T
150 gagtcggaaaccggtgcgaaa 170  Q
    |  |||||||||||| |||||    
7855 ggatcggaaaccggtacgaaa 7835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0341 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0341
Description:

Target: scaffold0341; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 54 - 127
Target Start/End: Original strand, 18624 - 18698
Alignment:
54 gtacccggagaataccggttt-gattcccaggaggaacaatgcttggccagtgcacatgtctatacgcacgagcc 127  Q
    ||||||| |||| ||||| || |||||| ||| ||||||| ||||||||||||||||||||| ||||||||||||    
18624 gtacccgaagaacaccgggttcgattcctagggggaacaacgcttggccagtgcacatgtctctacgcacgagcc 18698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 88 - 170
Target Start/End: Original strand, 16906 - 16988
Alignment:
88 aacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||| |||||| ||||||  |||||| ||||||||||||  |||||||| |||||||||||| || |||||||| |||||||    
16906 aacaacgcttggtcagtgcgtatgtctctacgcacgagccagattagtcgctcacctttggtgggttggaaaccgatgcgaaa 16988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 86 - 170
Target Start/End: Original strand, 41069 - 41153
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    |||||||  ||||| |||||  |||| || ||||||||||||| ||||||||  || |||||||||||||||||||||| |||||    
41069 ggaacaacacttggtcagtgtgcatgcctctacgcacgagccggattagtcgcccatctttggtgagtcggaaaccggttcgaaa 41153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 86 - 170
Target Start/End: Complemental strand, 65236 - 65152
Alignment:
86 ggaacaatgcttggccagtgcacatgtctatacgcacgagccgaattagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||| ||||||||||||| ||||||| |||||| |||| | |||||||| |||| |||| |   ||||||||||||||||||    
65236 ggaacaacgcttggccagtgcgcatgtctctacgcatgagctggattagtcgctcacttttgatagatcggaaaccggtgcgaaa 65152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0079 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0079
Description:

Target: scaffold0079; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 170
Target Start/End: Original strand, 8232 - 8272
Alignment:
130 attagtcgttcacctttggtgagtcggaaaccggtgcgaaa 170  Q
    ||||||||| ||||||||||  |||||||||||||||||||    
8232 attagtcgtccacctttggtaggtcggaaaccggtgcgaaa 8272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University