View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10545_low_7 (Length: 305)
Name: NF10545_low_7
Description: NF10545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10545_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 12 - 289
Target Start/End: Complemental strand, 49670006 - 49669729
Alignment:
| Q |
12 |
aaaggagaaggagaaggaagagtgtaattttggttcaaagtattacaaacattatcttgcaaacgtttgtaaaattcttgatcagaaagtgtaatggtat |
111 |
Q |
| |
|
||||||||||| | ||||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49670006 |
aaaggagaagggggaggaagagtgtaattgtggttcaaagtatcacaagcattatcttgcaaacgtttgtaaaaatcttgatcagaaagtgtaatggtac |
49669907 |
T |
|
| Q |
112 |
tgtggtcaatgacaccagttagctcaannnnnnnngcattcttctccagttgaatcattttgggtgaataataggtgtcgtcacagccatgtatgagtat |
211 |
Q |
| |
|
| ||||||| ||||||||||||||||| |||||||| |||||||| |||||||||||||||||||| |||| ||||||||| |||||||||| |
|
|
| T |
49669906 |
tctggtcaacgacaccagttagctcaattggttttgcattcttgtccagttggatcattttgggtgaataataactgtcatcacagccacgtatgagtat |
49669807 |
T |
|
| Q |
212 |
ggagccacagtctggttgttctgccttggtgaaaggataacggaaaatcccacgagctccacaactgaatgagtgtgg |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49669806 |
ggagccacagtctggttgttctgccttggtgaaagggtaatggaaaatcccacgagctccacaactgaatgagtgtgg |
49669729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University