View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10546_high_11 (Length: 235)
Name: NF10546_high_11
Description: NF10546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10546_high_11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 41275021 - 41275255
Alignment:
| Q |
1 |
atagaaagaaaaatatatataggggcagttcggtgtacaaaactttcacatacacaggatgtggaaagaggttccaccatagatagaaaaatatatgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41275021 |
atagaaagaaaaatatatataggggcagttcggtgtacaaaactttcacatacacaggatgtggaaagaggttccaccatagatagaaaaatatttgatt |
41275120 |
T |
 |
| Q |
101 |
taaaaattaatgtttgattagtattgtaaaacgatttatgtttaggacaattgtttttgcaaattgatttacaatgtgagactgaatgagtaatacttta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41275121 |
taaaaattaatgtttgattagtattgtaaaacgatttatgtttgggacaattgtttttgcaaattgatttacaatgtgagacggaatgagtaatacttta |
41275220 |
T |
 |
| Q |
201 |
taaagtagtagcatgaatattattatgaggtgttg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41275221 |
taaagtagtagcatgaatattattatgaggtgttg |
41275255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 106 - 143
Target Start/End: Complemental strand, 33975581 - 33975544
Alignment:
| Q |
106 |
attaatgtttgattagtattgtaaaacgatttatgttt |
143 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33975581 |
attaatgtttcattagtattgtaaaacgatttatgttt |
33975544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University