View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10546_high_13 (Length: 221)
Name: NF10546_high_13
Description: NF10546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10546_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 206
Target Start/End: Original strand, 35130820 - 35131008
Alignment:
| Q |
18 |
aatttgcttatctgaaatattatcatgtgaattagtacacatttttatcactatcaagctatttactctgggctttgcaggtttcattcaatgaggagaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35130820 |
aatttgcttatctgaaatattatcatgtgaattagtacacatttttatcactatcaagctatttactctgggctttgcaggtttcattcaatgaggagaa |
35130919 |
T |
 |
| Q |
118 |
catatggaaacagattcatgtcatccgtaagataataggatatgaaggtacaatccaagcatcatgtgcagatgaattgaaggctctct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35130920 |
catatggaaacagattcatgtcatccgtacgataataggatatgaaggtacaatccaagcatcatgtgcggatgaattgaaggctctct |
35131008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 86
Target Start/End: Complemental strand, 26778727 - 26778664
Alignment:
| Q |
22 |
tgcttatctgaaatattatcatgtgaattagtacacatttttatcactatcaagctatttactct |
86 |
Q |
| |
|
|||||||||||| ||||||||| ||| |||| ||||||||| ||||| ||| |||||||||||| |
|
|
| T |
26778727 |
tgcttatctgaa-tattatcatatgatttaggtcacatttttgtcactgtcaggctatttactct |
26778664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University