View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10546_low_20 (Length: 208)
Name: NF10546_low_20
Description: NF10546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10546_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 13060722 - 13060517
Alignment:
| Q |
1 |
tcaggtaaattagttt-aatattgctagaattgtgagactattaagtggttattacttaagccc-agttttgcttcttatttcactcattggactaaagt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13060722 |
tcaggtaaattagttttaatattgctagaattgtgagagtattaagtggttattacttaagccccagttttgtttcttatttcactcattggactaaagt |
13060623 |
T |
|
| Q |
99 |
tggtaccctgttgttattccttaaaaattttgcttcttaatattacaattactggggcaacattgagaatcaaattatgccctgaatcaaatgactcata |
198 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |||||| ||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
13060622 |
tggtaccctgttgttattccttcaaaattttgcttcttaatattacagttactgaggcaacattgagaatcaaattgtgccctgaatcaaatgact-ata |
13060524 |
T |
|
| Q |
199 |
ttatcta |
205 |
Q |
| |
|
||||||| |
|
|
| T |
13060523 |
ttatcta |
13060517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University