View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10547_high_2 (Length: 311)
Name: NF10547_high_2
Description: NF10547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10547_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 43533777 - 43533483
Alignment:
| Q |
1 |
ggcagcagatccagcagcacggaggggaaggagtttggcggaagtgaaaagaggaggggaagcaatccatctggcaatggaatttccaatgtcgacgctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43533777 |
ggcagcagatccagcagcacggaggggaaggagtttggcggaagtgaaaagaggagtggaagcaatccatctggcaatggaatttccaatgtcgacactg |
43533678 |
T |
 |
| Q |
101 |
ggaccctcaggacccaaggaattaccagtacctaaagtaatagaagctgcaatagcctttaagaaagggttggaattggaatt------ggaaagaaggt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
43533677 |
ggaccctcaggacccaaggaattaccagtacctaaagtaatagaagctgcaatagcctttaagaaagggcgggaattggaattggaattggaaagaaggt |
43533578 |
T |
 |
| Q |
195 |
tgagaagagaaacaagaagacctccaaaagcgggaacaagtattacacttttccatgtttcttgaataggagcttctctcaaccatgaggcacct |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43533577 |
tgagaagagaaacaagaagacctccaaaagcgggaacaagtattacacttttccatgtttcttgaataggagcttctctcaaccatgaggcacct |
43533483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University