View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10547_high_4 (Length: 277)
Name: NF10547_high_4
Description: NF10547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10547_high_4 |
 |  |
|
| [»] scaffold0450 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0450 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: scaffold0450
Description:
Target: scaffold0450; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 7 - 261
Target Start/End: Original strand, 9704 - 9958
Alignment:
| Q |
7 |
gaagcaaaggaacgatggctgcttcgtttttgtcatcaagtttcttaaccaggaacttaaaatttggtgatactagttaccgaaatcaaagtatagttgg |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9704 |
gaagaaaaggaacgatggctgcttcgtttttgtcatcaagtttcttaaccaggaacttaaaatttggtgatactagttaccgaaatcaaagtatagttgg |
9803 |
T |
 |
| Q |
107 |
aaaagattcgttcaatcatttcaattatggtgggaagaactggagcgttggatctacaggcaagtctaacattttgcctaacgttactttttcttcaatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9804 |
aaaagattcgttcaatcatttcaattatggtgggaagaactggagcgttggatctacaagcaagtctaacattttgcctaacgttactttttcttcaatc |
9903 |
T |
 |
| Q |
207 |
aagattagatcaactgaagtgggaacaggaactgcgaagaaaggaaggttagata |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||| ||| |||| |
|
|
| T |
9904 |
aagattagatcaactgaagtgggaacaggaactacgaataaaggaaagtttgata |
9958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University