View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10547_low_11 (Length: 286)
Name: NF10547_low_11
Description: NF10547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10547_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 38752106 - 38752340
Alignment:
| Q |
1 |
atttattagtaaattcaccacctgcatagatcaacacaatgcttatgtattttttctcttttaatagccaaaattttattagaaactcaaaccagtgcat |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38752106 |
atttattagttaattcaccacctgcatagatcaacacaatgcttatgtattttttctcttttaatagccaaaattttattagaaactcaaaccagtgcat |
38752205 |
T |
 |
| Q |
101 |
caataatacaccaactatattaactgcgcgaatttgacagaataacagtttgccacgtcttggtttcggcaaaa---actacactttgaatcttaaacaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38752206 |
taataatacaccaactatattaactgcgcgaatttgacagaataacagtttgccacgtcttggtttcggcaaaaactactacactttgaatcttaaacaa |
38752305 |
T |
 |
| Q |
198 |
aacctcgatgccatcgtgattttgtcaaatatatt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38752306 |
aacctcgatgccatcgtgattttgtcaaatatatt |
38752340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University