View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10547_low_13 (Length: 272)
Name: NF10547_low_13
Description: NF10547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10547_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 58 - 255
Target Start/End: Original strand, 4247302 - 4247494
Alignment:
| Q |
58 |
tttgaaggtccttagcttgagcttgatatcaaatcaccgatagtcttgttagctgcatattgtacataacattttgtttggggttgtctccaatggagaa |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4247302 |
tttgaaggtccttagcttgagcttgatatcaaatcaccaatagtcttgttagctgcatattgtacataacattttgtttggggttgtctccaatggagaa |
4247401 |
T |
 |
| Q |
158 |
tttgtccaatcactttatcatgttcattttctatgcatattatatttgttgatgaaatgcaaatccttaatgccagtttttggtcgagcatctgtgtt |
255 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4247402 |
tctgtccaatcactttatcatgttcattttctatgc-----atatttgttgatgaaatgcaaatccttaatgccagtttttggtcgagcatctgtgtt |
4247494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University