View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10547_low_14 (Length: 259)
Name: NF10547_low_14
Description: NF10547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10547_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 41 - 245
Target Start/End: Original strand, 42639037 - 42639236
Alignment:
| Q |
41 |
aaggaaaacactagtatatttataattcaagcacaacaacaacgtagannnnnnnaaaatatatataacaatgtagaaattgtttcnnnnnnntatttgt |
140 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42639037 |
aaggaaaacactagtat--ttataattcaagtacaacaac---gtagatttttttaaaatatatataacaatgtagaaattgtttcaaaaaaatatttgt |
42639131 |
T |
|
| Q |
141 |
tattgttgtgaactttgagannnnnnngggtgtaccgttaatgttgagatttattttcacttccctaagnnnnnnnnaagtacttttattatgttaaaga |
240 |
Q |
| |
|
||| |||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42639132 |
tatcgttgtgaactttgagatttttttgggtgtgccgttaatgttgagatttattttcacttccctaagttttttttaagtacttttattatgttaaaga |
42639231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University