View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10547_low_16 (Length: 250)
Name: NF10547_low_16
Description: NF10547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10547_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 38752125 - 38751887
Alignment:
| Q |
1 |
tggtgaatttactaataaatgcattttcttcttcttgatctttgtaggtggtcaatttacaagcacagctagcttttctgagagagcaaacagctcaaag |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38752125 |
tggtgaattaactaataaatgcattttcttcttcctgatctttgtaggtggtcaatttacaagcacagctagcttttctgagagagcaagcagctcaaag |
38752026 |
T |
 |
| Q |
101 |
gtgtatcaatgccccaaattctgcaaaccctaatgagaagaactttggaaaacctactaatattctccctcaagatcttcaaagttggttccagatggaa |
200 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38752025 |
gtgtctcaatgccccaaattctgaaaaccctaatgagaagaactttggaaaacctactaatattctccctcaagatcttcaaagttggttccagatggaa |
38751926 |
T |
 |
| Q |
201 |
aattccaacatgtgttctcaatttcttcccgatttctct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38751925 |
aattccaacatgtgttctcaatttcttcccgatttctct |
38751887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 30904515 - 30904559
Alignment:
| Q |
164 |
tctccctcaagatcttcaaagttggttccagatggaaaattccaa |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
30904515 |
tctccctcaagatcttcaaacttggttccatgtggaaaattccaa |
30904559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University