View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10547_low_17 (Length: 242)
Name: NF10547_low_17
Description: NF10547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10547_low_17 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 51109297 - 51109074
Alignment:
| Q |
19 |
acaccaaacctcagttacggttaattcaaccgttgaggttatgtcatttctgcatcgaatcggaaactttaggctgaataccgagaggacatttcaattt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51109297 |
acaccaaacctcagttacggttaattcaaccgttgaggttatgtcatttctgcatcgaatctgaaactttaggctgaataccgagaggacatttcaattt |
51109198 |
T |
|
| Q |
119 |
cgcagatgttacactcacctgcttcatgcttctttctcaaattctattcccaaacctaaaactctccctactgttatgccatattcgcattcgcttttcc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51109197 |
cgcagatgttacactcacctgcttcatgcttctttctcaaattctattcccgaacctaaaactctccctactgttatgccatattcgcattcgcttttcc |
51109098 |
T |
|
| Q |
219 |
ataatactagacccataaatgttt |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
51109097 |
ataatactagacccataaatgttt |
51109074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 160 - 242
Target Start/End: Complemental strand, 51116719 - 51116637
Alignment:
| Q |
160 |
ttctattcccaaacctaaaactctccctactgttatgccatattcgcattcgcttttccataatactagacccataaatgttt |
242 |
Q |
| |
|
||||| |||||| ||||||||||||||||| |||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51116719 |
ttctactcccaagcctaaaactctccctacggttatgccatattcacattcgcttttccatagtactagacccataaatgttt |
51116637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 53
Target Start/End: Complemental strand, 51103850 - 51103822
Alignment:
| Q |
25 |
aacctcagttacggttaattcaaccgttg |
53 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51103850 |
aacctcagttacggttaattcaaccgttg |
51103822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University