View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10548_4 (Length: 434)
Name: NF10548_4
Description: NF10548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10548_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 1e-35; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 63 - 166
Target Start/End: Complemental strand, 6175595 - 6175491
Alignment:
| Q |
63 |
taatcataagaatagaaaatcagatgggttaagtggctcatatcacttgtaaatttag-aagatctatgattgtagaaaaaacccgatttactttgaagg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||| ||| |||||||||| |
|
|
| T |
6175595 |
taatcataagaatagaaaatcagatgggttaagtggctcatagtacttgtaaatttagaaagatctatgattgtaggaaaaacccaattcactttgaagg |
6175496 |
T |
|
| Q |
162 |
agtgt |
166 |
Q |
| |
|
||||| |
|
|
| T |
6175495 |
agtgt |
6175491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 63 - 121
Target Start/End: Complemental strand, 6176346 - 6176288
Alignment:
| Q |
63 |
taatcataagaatagaaaatcagatgggttaagtggctcatatcacttgtaaatttaga |
121 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| || |||||||| ||||||||||||| |
|
|
| T |
6176346 |
taatcataagaatagaaaatcatatgggttaaggggatcatatcaattgtaaatttaga |
6176288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 201 - 251
Target Start/End: Complemental strand, 6175456 - 6175405
Alignment:
| Q |
201 |
ccgaaactgagatatcaaacaaa-gttagcaccttcaattgatggaagttag |
251 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
6175456 |
ccgaaactgagatatcaaacaaaagttagcactttcaattgatggaagttag |
6175405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 63 - 107
Target Start/End: Complemental strand, 6172609 - 6172565
Alignment:
| Q |
63 |
taatcataagaatagaaaatcagatgggttaagtggctcatatca |
107 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
6172609 |
taatcataagattagaaaatcagatgggttaagaggctcatatca |
6172565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University