View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10548_high_1 (Length: 256)
Name: NF10548_high_1
Description: NF10548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10548_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 2814284 - 2814543
Alignment:
| Q |
1 |
gtatgctgcaccgaccgaactatacatatacatatagagcacacagctgtaataagtatctgtcagtgtcacgtggttgagcactcagcagtgctaaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
2814284 |
gtatgctgcaccgaccgaactatacatatacatatggagcacacagctgtaataagtatctgtcagtgtcacgtggttgagcactcaacactgctaaaaa |
2814383 |
T |
 |
| Q |
101 |
cacagaacacaa---------------gggcaaaattagattgatggaattcgtttaatctaagaaaatcattttcgtgatatgctagatctaagaaaat |
185 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2814384 |
cacagaacacaaacacagaacacaaaagggcaaaattagattgatggaagtcgtttaatctaagaaaatcatttccgtgatatgctagatctaagaaaat |
2814483 |
T |
 |
| Q |
186 |
ctagatttgtttatgtctattttctttcatcttctttaatttttgttggtttcttctcac |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2814484 |
ctagatttgtttatgtctattttctttcatcttctttaatttttgttggtttcttctcac |
2814543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University