View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10548_low_6 (Length: 237)
Name: NF10548_low_6
Description: NF10548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10548_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 9 - 222
Target Start/End: Original strand, 803349 - 803554
Alignment:
| Q |
9 |
gcatagcaaagtctttaccatttgacaaagtcaagttnnnnnnncatatgagagatctactacgtcattaggaactgagattaattctcaattggagagt |
108 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
803349 |
gcatagcatagtctttaccatttgacaaagtcaagttaaaaaaacatatgagagatctactacgtcattaggaactgagatt----ctcaattggagagt |
803444 |
T |
 |
| Q |
109 |
gggatatctaaaattaatttcagtttatatattgtgtctattcaaataagtgtcctcggattaaggtgtctgctcacccaaaacttgttgaatttggttc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
803445 |
gggatatctaaaattaatttcagtttat----tgtgtccattcaaataagtgtcctcggattaaggtgtctgctcacccaaaacttgttgaatttggttc |
803540 |
T |
 |
| Q |
209 |
gttactgttatttg |
222 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
803541 |
gttactgttatttg |
803554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University