View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10549_low_1 (Length: 238)
Name: NF10549_low_1
Description: NF10549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10549_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 223
Target Start/End: Complemental strand, 44682606 - 44682392
Alignment:
| Q |
9 |
tgttaaagtacacttttttatgataaaatttgtccataaatgtacttttggaggacacaaaaattatatactttttctgaatatatatttatgaagtgat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44682606 |
tgttaaagtacacttttttatgataaaatttgtccataaatgtacttttggaggacacaaaaattatatactttttctgaatatatatttatgaagtgat |
44682507 |
T |
 |
| Q |
109 |
cttgggtgtaaacaatttctctctacatatttataaccaaaattgactatagaaacaaaacaaaaaaggtaacttcaagataaattggagtaacttttaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44682506 |
cttgggtgtaaacaatttctctctacatatttataaccaaaattgactatagaaacaaaacaaaaaaggtaacttcaagataaattggagtaacttttaa |
44682407 |
T |
 |
| Q |
209 |
ctaatttactagaag |
223 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
44682406 |
ctaatttactagaag |
44682392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University