View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10550_3 (Length: 380)
Name: NF10550_3
Description: NF10550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10550_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 21 - 252
Target Start/End: Complemental strand, 43311166 - 43310935
Alignment:
| Q |
21 |
taactgatatagttctgcactttaactgaaatacactattcagtttagtaaagtcaaattcataaaaactatatgaatgtggatcaaaattacatggcag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43311166 |
taactgatatagttctgcactttaactgaaatacactattcagtttagtaaagtcaaattcataaaaactatatgaatgtggatcaaaattacatggcag |
43311067 |
T |
|
| Q |
121 |
tcattcacatttttgctattattgaactgatgaattaaaagtagattgcatctgattgtaattgtaacattttaatgtaatagaaaaataatactgttaa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43311066 |
tcattcacatttttgctattattgaactgataaattaaaagtagattgcatctgattgtaattgtaacattttaatgtaatagaaaaataatactgttga |
43310967 |
T |
|
| Q |
221 |
atagagttatatagttttctcacacaggttct |
252 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
43310966 |
atagagttatatagttttctcacacagattct |
43310935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 252 - 351
Target Start/End: Complemental strand, 8682843 - 8682744
Alignment:
| Q |
252 |
tgctcgttcactggctgtggtgctggcttcacttcctctacttttgtgccaccacctgcatttttaccaccgccttcattggccgttttgttgtcatcac |
351 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8682843 |
tgctctttcactggctgtggtgctggcttcacttcctctacttttgagccaccacctgcatttttaccaccgccttcattggccgttttgttgtcatcac |
8682744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University