View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10550_low_7 (Length: 233)
Name: NF10550_low_7
Description: NF10550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10550_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 9 - 222
Target Start/End: Original strand, 35451221 - 35451434
Alignment:
| Q |
9 |
agcagcacagatatgggagtttcggaagagggaggatggcgatgggtgtttctttggctcaggcggctgtttgtttgggaggaagagatgctcaataacc |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35451221 |
agcatcacagatatgggagtttcggaagagggaggatggcgatgggtgtttctttggctcaggcggctgtttgtttgggaggaagagatgctcaataacc |
35451320 |
T |
|
| Q |
109 |
acatggtgcagttaggcacaatgtcactgatggattaggaagatatgtggagatgggttcttgagtctgaagaaaagttcacggctaagtctacttatga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35451321 |
acatggtgcagttaggcacaatgtcactgatggattaggaagatatgtggagatgggttcttgagtctgaagaaaagttcacggctaagtctacttatga |
35451420 |
T |
|
| Q |
209 |
atttgtctgtgctc |
222 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
35451421 |
atttgtctctgctc |
35451434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University