View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10550_low_8 (Length: 227)
Name: NF10550_low_8
Description: NF10550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10550_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 8921426 - 8921217
Alignment:
| Q |
1 |
ttaaataacaatgtggatatatacactttagtaattgtttattgtctactagctaaaacaaaggtgtatggggcatgtagagtt-gacggggattagatt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
8921426 |
ttaaataacaatgtggatatatacactttagtaattgtttattgtctactagctaaaacaaaggtgtatggggcatgcagagtttgacggggattagatt |
8921327 |
T |
|
| Q |
100 |
cattcaactttaggtctttactcacatgcagtgttgctttctatagtgcctgcgccagattgtgtctcttgaagtggagagagataattagtggaggtaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8921326 |
cattcaactttaggtctttactcacatgcagtgttgctttctatagtgcctgcgccagattgtgtctcatgaagtggagagagataattagtggaggtaa |
8921227 |
T |
|
| Q |
200 |
ttaaatagtt |
209 |
Q |
| |
|
|||||||||| |
|
|
| T |
8921226 |
ttaaatagtt |
8921217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University