View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10551_low_16 (Length: 250)
Name: NF10551_low_16
Description: NF10551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10551_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 17074466 - 17074665
Alignment:
| Q |
1 |
tacggttagtttttcaatttgggaaaattggtgttaaccagttagaaaaatcttaatcatgtgaaatttcactattagaaactgcattggagaggacaca |
100 |
Q |
| |
|
|||||||||||||||||||| |||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17074466 |
tacggttagtttttcaatttaggaaaagtagtgttaaccagttagaaaaatcttaatcatgtgaaatttcactattagaaactgcattggagaggacaca |
17074565 |
T |
|
| Q |
101 |
gcaggggcggaactacagtgaggcatggtgtggcagctgccaatccagattctagcccaannnnnnnnnnatatgcataacataaggtatgggaaagtgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
17074566 |
gcaggggcggaactacagtgaggcatggtgtggcagctgccactccagattctagctcaattttttttttatatgcataacataaggtatgggaaagtgg |
17074665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University