View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10551_low_18 (Length: 240)
Name: NF10551_low_18
Description: NF10551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10551_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 18260635 - 18260407
Alignment:
| Q |
18 |
atgcatgcatttacacaccctgcaggcatcgttggtgttcagctctgtttgcaatacgtatgtatgaactactcttcttagactt--------------- |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18260635 |
atgcatgcatttacacaccctgcaggcatcgttggtgttcagctctgtttgcaatacgtatgtatgaactactcttcttagacttgtgactgaatatatt |
18260536 |
T |
|
| Q |
103 |
----ttgactcatctaagactgtcctgattttactgtatcataaatattgcagtcaatctttttgtagtttatacatcatcgtggaagaaaatttataac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
18260535 |
ggctttgactcatctaagactgtcctgattttactgtatcataaatcttgcagtcaatctttttctagtttatacatcatcttggaagaaaatttataac |
18260436 |
T |
|
| Q |
199 |
tgtgcaaatacaaattttaacttgtgggt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18260435 |
tgtgcaaatacaaattttaacttgtgggt |
18260407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University