View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10551_low_25 (Length: 202)
Name: NF10551_low_25
Description: NF10551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10551_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 9 - 183
Target Start/End: Original strand, 37936176 - 37936350
Alignment:
| Q |
9 |
agaagcaaaggatacaaacatgaacattagatgattgaagctaataattaagaatgacaatcgagtataatcatatgtgtcggtgctttacaatgttgga |
108 |
Q |
| |
|
||||||||| |||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37936176 |
agaagcaaaagatacaaacacggacattagataattgaagctaataattaagaatgacaatcgagtataatcatatgtgtcggtgctttacaatgttgga |
37936275 |
T |
|
| Q |
109 |
ctagacatgtcttctatcagaaattatcgagaaaattcacaaatttggcttagtacctgaatcctcgcatagtca |
183 |
Q |
| |
|
| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37936276 |
ccagacacgtcttctatcataaattatcgagaaaattcacaaatttggcttagtacctgaatcctcgcatagtca |
37936350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University