View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10552_low_2 (Length: 387)
Name: NF10552_low_2
Description: NF10552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10552_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 7 - 371
Target Start/End: Complemental strand, 52785009 - 52784645
Alignment:
| Q |
7 |
gtagcaaaggcatcagttccagatccaatcatcgaagaggccatgaattatgcctgttggtcaggagcagactgcagttcgattcagccgaacgggcctt |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52785009 |
gtagctaaggcatcagttccagatccaatcatcgaagaggccatgaattatgcctgttggtcaggagcagactgcagttcgattcagccgaacgggcctt |
52784910 |
T |
 |
| Q |
107 |
gctttcagcccgacagtgtatttgcacatgcttcctatgccttcaatagttactggcaaaggacgaaagcttctggtggcacttgcgagtttggagggac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52784909 |
gctttcagcccgacagtgtatttgcacatgcttcctatgccttcaatagttactggcaaaggacgaaagcttctggtggcacttgcgagtttggagggac |
52784810 |
T |
 |
| Q |
207 |
agccgtattagtttcggttgaccctagtgagtaatttaatttagtaaacttgtttggttcattttatgccaaagtaacaaactcataattgctacctttt |
306 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52784809 |
agccgtattagtttcagttgaccctagtgagtaatttaatttagtaaacttgtttggttcattttatgccaaagtaacaaactcataattgctacctttt |
52784710 |
T |
 |
| Q |
307 |
gcttctcaacaggctacgacggatgtcacttcatctataactaactgatcaaggagctaagaaag |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52784709 |
gcttctcaacaggctacgacggatgtcacttcatctataactaactgatcaaggagctaagaaag |
52784645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University