View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10553_high_5 (Length: 282)
Name: NF10553_high_5
Description: NF10553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10553_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 17 - 272
Target Start/End: Complemental strand, 40557148 - 40556893
Alignment:
| Q |
17 |
cacataatccaaagacaattcctctgttggtgtcagaaagttctcttcaatcttacctattggaatggacaagcggctttgatctttgtccacgtcactc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40557148 |
cacataatccaaagacaattcctctgttggtgtcagaaagttctcttcaatcttacctattggaatggacaagcggctttgatctttgtccacgtcactc |
40557049 |
T |
 |
| Q |
117 |
attgtcagttccttctggatcaccaacttcacctcacaacctcccatttgttccatcttttctttaaacaccaatggaagctccggtttctcttcttgca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40557048 |
attgtcagttccttctggatcaccaacttcacctcacaaccttccatttgttcaatcttttctttaaacgccaatggaagctccggtttctcttcttgca |
40556949 |
T |
 |
| Q |
217 |
cctggttcttgcgtttctttgacggtttgcttgatcgttcattcttgtcttttctt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40556948 |
cctggttcttgcgtttctttgacggtttgcttgatcgttcattcttgtcttttctt |
40556893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University