View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10553_low_17 (Length: 240)
Name: NF10553_low_17
Description: NF10553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10553_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 31221075 - 31220853
Alignment:
| Q |
1 |
taagttgtttatccaaaggtagaaatacttgtctcagagccaagggcgaaaattcagtagaggaaatcccagtgcacaccatgtttgatatacttttatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31221075 |
taagttgtttatccaaaggtagaaatacttgtctcagagccaagggcgaaaattcagtagaggaaatcccagtgcacaccatgtttgatatacttttatg |
31220976 |
T |
|
| Q |
101 |
acttttccttcgtaagctctcagattgtttccctattggaaggaagtagaatctttgtttttatgtgatgttgcagatacagtttactcttctacatgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31220975 |
acttttccttcgtaagctctcagattgtttccctattggaaggaagtagaatctttgtttttatgtgatgttgcagatacagtttagtcttctacatgtt |
31220876 |
T |
|
| Q |
201 |
tttatattgcaagtacttatagg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31220875 |
tttatattgcaagtacttatagg |
31220853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 80 - 142
Target Start/End: Complemental strand, 31245856 - 31245791
Alignment:
| Q |
80 |
catgtttgatata---cttttatgacttttccttcgtaagctctcagattgtttccctattggaag |
142 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||| | ||||||||| ||||||| |
|
|
| T |
31245856 |
catgtttgatatatcccttttatgatttttccttcgtaagctctcgaaatgtttccctcttggaag |
31245791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University