View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10553_low_29 (Length: 217)
Name: NF10553_low_29
Description: NF10553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10553_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 222060 - 221879
Alignment:
| Q |
19 |
gaattaagtgtgatgaagaagatccagtgggaggaagcaatgatgctgctaaagacgaggaaaacatccaaggtgaactcgaatctagttgtcaagaacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
222060 |
gaattaagtgtgatgaagaagatccagtgggaggaagcaatgatgctgctaaagacgaggaaaacatccaaggtgaactcgaatctagttgtcaagaacc |
221961 |
T |
|
| Q |
119 |
ttctgcatcagttagtagcctccgctcagtaaatgaaattccaacttctgcctccaccaagccttctaagcagtgtcattca |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
221960 |
ttctgcatcagttagtagcctccgctccgtaaatgaaattccaacttctgcctccaccaagccttctaagcagtgtcattca |
221879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University