View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10553_low_32 (Length: 208)
Name: NF10553_low_32
Description: NF10553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10553_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 4 - 133
Target Start/End: Original strand, 40114248 - 40114377
Alignment:
| Q |
4 |
aagtagaagatgtagtgggcagattattacctgatgaagaacttgagtgcaaggttgcctcttgaggatttgcaacagatgtagaggtagtggtggtcgc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40114248 |
aagtagaagatgtagtgggcagattattacctgatgaagaacttgagtgcaaggttgcctcttgaggatttgcaacagatgtagaggtagtggtggtcac |
40114347 |
T |
|
| Q |
104 |
agtttgtgaagtattagttgtaagtggtgg |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40114348 |
agtttgtgaagtattagttgtaagtggtgg |
40114377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University