View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10554_low_3 (Length: 389)
Name: NF10554_low_3
Description: NF10554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10554_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 1 - 374
Target Start/End: Complemental strand, 8447120 - 8446747
Alignment:
| Q |
1 |
aaagggaacaaacaactgtatgatacaaatccattggcaaaggcttcaatagatcaatggttagaagctgaaggacaaagcttcaatccaccttcttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8447120 |
aaagggaacaaacaactgtatggtacaaatccattggcaaaggcttcaatagatcaatggttagaagctgaaggacaaagcttcaatccaccttcttcaa |
8447021 |
T |
 |
| Q |
101 |
ctctggtgtttcagcttgcatttgctcctcgaatgaagatcaaacaagacgaaggagcaattcgacagagtaaagaaaagctcaagaaagtgcttgatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8447020 |
ctctggtgtttcagcttgcatttgctcctcgaatgaagatcaaacaagacgaaggagcaattcgacagagtaaagaaaagctcaagaaagtgcttgatgt |
8446921 |
T |
 |
| Q |
201 |
gtacgataagaggcttggggaaactcgctacttggctggtgatgagttcacacttgccgacctttcacatcttcccaatattcactacttggtggctgct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8446920 |
gtacgataagaggcttggggaaactcgctacttggctggtgatgaattcacacttgccgacctttcacatcttcccaatattcactacttggtggctgct |
8446821 |
T |
 |
| Q |
301 |
gctgatgccgacaccgctgatttgtttacttcttcgtcaagaaacaatgtgtcaaggtggtggacggaaatatc |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8446820 |
gctgatgccgacaccgctgatttgtttacttcttcgtcaagaaacaatgtgtcaaggtggtggacggaaatatc |
8446747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University