View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10555_high_10 (Length: 250)
Name: NF10555_high_10
Description: NF10555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10555_high_10 |
 |  |
|
| [»] scaffold0076 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 29568453 - 29568214
Alignment:
| Q |
1 |
ttcctagcacactgcacataattaacaaatacatgtattagcacaagtccataatcaaataagattagtttccaacaaatccagaatcggaatcatttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29568453 |
ttcctagcacactgcacataattaacaaatacatgtattagcacaagtcattaatcaaataagattagtttccaacaaatccagaatcggaatcatttaa |
29568354 |
T |
 |
| Q |
101 |
tcttagaacttacgttggagtaagcagctgatctgaacttcttgattccaccgtttggacgaacgtattcaatagtgtagccgaggggagcttcgtaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29568353 |
tcttagaacttacgttggagtaagcagctgatctgaacttcttgattccaccgtttggacgaacgtattcaatagtgtagccgaggggagcttcgtaaaa |
29568254 |
T |
 |
| Q |
201 |
taacgattcactactactggacttcttcttgcctcctttg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29568253 |
taacgattcactactactggacttcttcttggctcctttg |
29568214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0076 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: scaffold0076
Description:
Target: scaffold0076; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 108 - 203
Target Start/End: Complemental strand, 3863 - 3768
Alignment:
| Q |
108 |
acttacgttggagtaagcagctgatctgaacttcttgattccaccgtttggacgaacgtattcaatagtgtagccgaggggagcttcgtaaaataa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||| |||| ||||||||||||||||| ||||| |
|
|
| T |
3863 |
acttacgttggagtaagcagctgatctgaacttcttgattccaccgttaggacgaatgtcttcaatgctgtatccgaggggagcttcgtagaataa |
3768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University