View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10555_high_13 (Length: 240)
Name: NF10555_high_13
Description: NF10555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10555_high_13 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 29568531 - 29568752
Alignment:
| Q |
1 |
ctcttcttcaaacgacgtctttccagtctctatttttgcaattgtgctgtcgttgttcactgctttcgggttttggtgctgtgcattttctttttctgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29568531 |
ctcttcttcaaacgacgtctttccagtctctatttttgcaattgtgctgttgttgttcactgctttcgggttttggtgctgtgcattttctttttctgaa |
29568630 |
T |
 |
| Q |
101 |
acaatatggccttggcagtttcttcaatcggttttgaaggctttgaaaagaggctagagatatcatttttcgaaccgggagtatttttggaccctgaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29568631 |
acaatatggccttggcagtttcttcaatcggttttgaaggctttgaaaagaggctagagatatcatttttcgaaccgggagtatttttggaccctgaagg |
29568730 |
T |
 |
| Q |
201 |
aaaggatcttagatctctaaca |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29568731 |
aaaggatcttagatctctaaca |
29568752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 174
Target Start/End: Complemental strand, 363578 - 363531
Alignment:
| Q |
127 |
atcggttttgaaggctttgaaaagaggctagagatatcatttttcgaa |
174 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||| | ||||||||| |
|
|
| T |
363578 |
atcggttttgaaggctatgaaaagaggcttgagataacttttttcgaa |
363531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 174
Target Start/End: Complemental strand, 5903445 - 5903398
Alignment:
| Q |
127 |
atcggttttgaaggctttgaaaagaggctagagatatcatttttcgaa |
174 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||| | ||||||||| |
|
|
| T |
5903445 |
atcggttttgaaggctatgaaaagaggcttgagataacttttttcgaa |
5903398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 174
Target Start/End: Original strand, 5911758 - 5911805
Alignment:
| Q |
127 |
atcggttttgaaggctttgaaaagaggctagagatatcatttttcgaa |
174 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||| | ||||||||| |
|
|
| T |
5911758 |
atcggttttgaaggctatgaaaagaggcttgagataacttttttcgaa |
5911805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University