View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10555_low_10 (Length: 284)
Name: NF10555_low_10
Description: NF10555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10555_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 14 - 268
Target Start/End: Original strand, 44541773 - 44542027
Alignment:
| Q |
14 |
acattaagagattcctgtaagccacgggtcagcagaactaggagcattagcaatcctaacatcagcatgggcataacccatgatgtcaatattgatggtt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44541773 |
acattaagagattcctgtaagccacgggtcagcagaactaggagcattagcaatcctaacatcagcatgggcataacccaggatgtcaatattgatggtt |
44541872 |
T |
|
| Q |
114 |
gttccttttgcagcatagtgaaattcactgtttcgttcaaaattgcttctttttgtactgcatcttcatttccaacatagcgtgaaccatcgtttgcata |
213 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44541873 |
gttccttttgcagcatagtgaaattcgctgtttcgttcaaaattgcttctttttgtactgcatcttcatttccaacatagcgtgaaccatcgtttgcata |
44541972 |
T |
|
| Q |
214 |
taagtcactgcaaacattgctttcacagtaatatttcttgaattcttgttctatc |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44541973 |
taagtcactgcaaacattgctttcacagtaatatttcttgaattcttgttctatc |
44542027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University