View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10555_low_18 (Length: 227)
Name: NF10555_low_18
Description: NF10555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10555_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 26 - 93
Target Start/End: Complemental strand, 10255421 - 10255354
Alignment:
| Q |
26 |
gagggtgtggatgagatctgaagtgagagttccacgagtgtgttttcagaaagagaaatgtgtttgag |
93 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10255421 |
gagggtgaggatgagatctgaagtgagagttccacgagtgtgttttcagaaagagaaatgtgtttgag |
10255354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 170 - 227
Target Start/End: Complemental strand, 10255277 - 10255220
Alignment:
| Q |
170 |
tcagtcaaattggtattaattattatgatatttactaccattacatttcctagcagta |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10255277 |
tcagtcaaattggtattaattattatgatatttactaccattacatttcctagcagta |
10255220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 170 - 224
Target Start/End: Original strand, 19412031 - 19412085
Alignment:
| Q |
170 |
tcagtcaaattggtattaattattatgatatttactaccattacatttcctagca |
224 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19412031 |
tcagtcaaattgtagttaattattatgatatttactaccattacatttccgagca |
19412085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 224
Target Start/End: Complemental strand, 7467410 - 7467371
Alignment:
| Q |
185 |
ttaattattatgatatttactaccattacatttcctagca |
224 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7467410 |
ttaattataatgatatttactaccattacatttcctagca |
7467371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 224
Target Start/End: Original strand, 31023077 - 31023115
Alignment:
| Q |
186 |
taattattatgatatttactaccattacatttcctagca |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
31023077 |
taattattataatatttactaccattacatttcttagca |
31023115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University