View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10555_low_3 (Length: 417)
Name: NF10555_low_3
Description: NF10555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10555_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 19 - 334
Target Start/End: Original strand, 46729678 - 46729993
Alignment:
| Q |
19 |
acgttaaccccatttaaggatatccaagttgccgccaacatgctagctcaatccaccgtcgtggaccactttagttatgtttgtttattgtattcgttgg |
118 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46729678 |
acgttaaccccattcaaggatatccaagttgccgacaacatgctagctcaatccaccgtcgtggaccactttagttatgtttgtttattgtattcgttgg |
46729777 |
T |
 |
| Q |
119 |
aagcttctatggtggattggattgatttgggctgttttaagtctcgtaatggttttcctggttgctcgaaagagcattgactatgcggtggtgcttttag |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
46729778 |
aagcttctatggtggattggattgatttgggttgttttaagtctcgtaatggttttcctggttgctcgaaagagcattgactatgtggtggttcttttag |
46729877 |
T |
 |
| Q |
219 |
gagttacaagttgcttccaggtcactcatgcttgctatagtcgtagtgagttgttggttgtggatttgttactgtgttgacggtcaggttcctcgccagg |
318 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46729878 |
gagttacaagttgcttccaggccactcatgcttgctatagtcgtagtgagttgttggttgtggatttgttactgtgttgatggtcaggttcctcgccagg |
46729977 |
T |
 |
| Q |
319 |
cctcaagtctctgctc |
334 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
46729978 |
cctcaagtctatgctc |
46729993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 352 - 404
Target Start/End: Original strand, 30736479 - 30736531
Alignment:
| Q |
352 |
gatgaatacaattaatgcaacaatattggcaatggtgatgatgaataaagtga |
404 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
30736479 |
gatgaagacaattaaagcaacaacattggcaatggtgatgatgaatatagtga |
30736531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University