View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10556_low_4 (Length: 265)
Name: NF10556_low_4
Description: NF10556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10556_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 12 - 249
Target Start/End: Original strand, 36960836 - 36961073
Alignment:
| Q |
12 |
aagaagagcaaatcatagagagtattccactctcacttgttctgagtagggtttgggatgctaggtggtgctatcctcatacttggttccacaactttcc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36960836 |
aagaagagcaaatcatagagagtattcctctctcacttgttctgagtagggtttgggatgctaggtggtgctatcctcatacttggttccacaactttcc |
36960935 |
T |
 |
| Q |
112 |
tgttttgtttcttacttccacttattttaccattgattccacttgttgcaaaagaagcaaaagatgaagatagaagctcccttgacattgttaatctcgt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36960936 |
tgttttgtttcttacttccacttattttaccattgatgccacttgttgcaaaagaagcaaaagatgaagatagaagctcccttgacattgttaatctcgt |
36961035 |
T |
 |
| Q |
212 |
ctttcttgaaaacattggttcatggtggacacaacaac |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36961036 |
ctttcttgaaaacattggttcatggtggacacaacaac |
36961073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University