View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10556_low_5 (Length: 251)
Name: NF10556_low_5
Description: NF10556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10556_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 4474543 - 4474699
Alignment:
| Q |
1 |
taaccttggtgactcaagagcaatattaggaacaatccaagatgaaaaactcaaagccattcaattgaccactgatttgaagcctggtttgccttgtaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4474543 |
taaccttggtgactcaagagcaatattaggaacaatccaagatgaaaaactcaaagccattcaattaaccactgatttgaagcctggtttgccttgtaag |
4474642 |
T |
 |
| Q |
101 |
attcttctcataaactaactaccatgcagcttcttttcaagtattggtttgacggaa |
157 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4474643 |
attcctctcataaactaactaccatgcagcttcttttcaagtattggtttgacggaa |
4474699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University