View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10556_low_7 (Length: 238)
Name: NF10556_low_7
Description: NF10556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10556_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 20942 - 21093
Alignment:
| Q |
1 |
tgagagacgtctggagaaagaggaggagtgaaggggtgtttgtcgtagtaagacgacaggaaggccctagttatgggcaccaaaccctctgtagaagcag |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20942 |
tgagagacgtctgaagaaagaggaggagtgaaggggtgtttgtcgtagtaagacgacaggaaggccctagttatgggcaccaaaccctctgtagaagcag |
21041 |
T |
|
| Q |
101 |
cc------atcggaatcggaggattggattatcagacagatctaaatcccac |
146 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21042 |
ccatcggaatcggaatcggaggattggattatcagacagatctaaatcccac |
21093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University