View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10557_low_10 (Length: 238)
Name: NF10557_low_10
Description: NF10557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10557_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 42087361 - 42087133
Alignment:
| Q |
1 |
cgccggttattctagaatcatttcgttgaaaatttgtttcttcgacttaggttcgatactctgacacaccggatattcagacttgagacttcaaaacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42087361 |
cgccggttattctagaatcatttcgttgaaaatttgtttcttcgacttaggttcgatactctaacacaccggatattcagacttgagacttcaaaacaaa |
42087262 |
T |
|
| Q |
101 |
agttattcactca------ttcagtgtagttttattgctcttcccagcagctgataagaactcatcaatacccctaacagatgaccctttaactccatct |
194 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42087261 |
agttattcactcacgatcattcagtgtagttttattgctcttcccagcagctgataagaactcatcaatacccctaacagatgaccctttaactccatct |
42087162 |
T |
|
| Q |
195 |
tcttctccatctttcacagcattccttat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42087161 |
tcttctccatctttcacagcattccttat |
42087133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University