View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10557_low_11 (Length: 238)
Name: NF10557_low_11
Description: NF10557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10557_low_11 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 81 - 238
Target Start/End: Original strand, 1288037 - 1288194
Alignment:
| Q |
81 |
atttatatatcgtttggaattcattccaactaatcaattattctgggagccagttgatgatgcaaccctattaacatcgttatggagggttatccttata |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1288037 |
atttatatatcgtttggaattcattccaactaatcaatgattctgggagccagttgatgatgcaaccctattaacatcgttatggagggttatccttata |
1288136 |
T |
|
| Q |
181 |
cgtggtggaggagaaaatgggcagatagagaagttgagcagagattggatagaacgac |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1288137 |
cgtggtggaggagaaaatgggcagatagagaagttgagcagagattggatagaacgac |
1288194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University