View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10557_low_6 (Length: 250)
Name: NF10557_low_6
Description: NF10557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10557_low_6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 15 - 250
Target Start/End: Original strand, 8226414 - 8226649
Alignment:
| Q |
15 |
ggttagaaaattgctttcaatctatccatataataagaatcaaccatccaattccaagagcttaagttatttagtgaaggcacattttatattactctca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8226414 |
ggttagaaaattgctttcaatctatccatataataagaatcaaccatccaattccaagagcttaagttatttagtgaaggcacattttatattactctca |
8226513 |
T |
|
| Q |
115 |
ggtgatagactcgatctgctgctgcaatgcattttctattttgtctctagacgaagtggcaagcatcacccaaaactgacagctgtaaggtgccgggttc |
214 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8226514 |
ggtgatagactcgacccgctgctgcaatgcattttctattttgtctctagacgaagtggcaagcatcacccaaaactgacagctataaggtgccgggttc |
8226613 |
T |
|
| Q |
215 |
gaaacaagctgagctaaaccttttagactagaactc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8226614 |
gaaacaagctgagctaaaccttttagactagaactc |
8226649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University