View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10557_low_7 (Length: 246)
Name: NF10557_low_7
Description: NF10557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10557_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 38476447 - 38476648
Alignment:
| Q |
19 |
ggttgattttacataattgaataatttaagtcaagttagttcaaaactttcgtatataagttttgacatttaacattacagnnnnnnnnngtgttatata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| || ||||||| |
|
|
| T |
38476447 |
ggttgattttacataattgaataatttaagtcaagttagttcaaaactttcgtttataatttttgacatttaacattacagtttttttttgtattatata |
38476546 |
T |
 |
| Q |
119 |
cactttaacttgtgtgctgattccattttgctaaggattgtgtaaagcaagacatataaatcaaaattattggaagtataatgacagctaccttaatcta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38476547 |
cactttaacttgtgtgctgattccattttgctaaggattgtgtaaagcaagacatataaatcaaaattattggaagtataatgacagctaccttaatcta |
38476646 |
T |
 |
| Q |
219 |
ga |
220 |
Q |
| |
|
|| |
|
|
| T |
38476647 |
ga |
38476648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University