View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10557_low_8 (Length: 240)
Name: NF10557_low_8
Description: NF10557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10557_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 12 - 195
Target Start/End: Original strand, 42843701 - 42843884
Alignment:
| Q |
12 |
acgaacaaatctatttgcattgaaaagctttttccctccataattcttaaaaatcgtttctgtctgaattgacttacgggaaaaaagagtggtttatcct |
111 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
42843701 |
acgaacaaatatatttgcattgaaaagctttttccctccataattcttaaaaatcgtttctgtctgaattgacttacgcgaaaaaatagtggtttatcct |
42843800 |
T |
 |
| Q |
112 |
atttgaatgagtaacttaatatggaaacgatttttgagaaatcattgggaataaaagtaactatctttattatatttatttcaa |
195 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42843801 |
atttgaatgagtaacttaatatgaaaacgatttttgagaaatcattgggaataaaagtaactatctttattatatttatttcaa |
42843884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University