View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10558_low_3 (Length: 295)
Name: NF10558_low_3
Description: NF10558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10558_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 29 - 234
Target Start/End: Complemental strand, 34704998 - 34704793
Alignment:
| Q |
29 |
ttttgattaatgattggaactaaatataaacctgcagaattttgcagatttgggtacatctttgaagtatttctgtccttgtgtgtctaagtgccggaga |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
34704998 |
ttttgattaatgattggaactaaatataaacctgcagaattttgcagatttgggtacatctttgaagcatttctgtccttgtgtgtctaagtgcaggaga |
34704899 |
T |
|
| Q |
129 |
ggccgcattagctttctcatgtattatgtgagggtattttgctgaacttaatttgatatttggagtctaagactcttaagttagtactgtgtccgttgat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34704898 |
ggccgcattagctttctcatgtattatgtgagggtattttgctgaacttaatttgatatttggagtctaagactcttaagttagtactgtgtccgttgat |
34704799 |
T |
|
| Q |
229 |
aattgt |
234 |
Q |
| |
|
|||||| |
|
|
| T |
34704798 |
aattgt |
34704793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University