View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10558_low_4 (Length: 283)
Name: NF10558_low_4
Description: NF10558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10558_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 18 - 135
Target Start/End: Complemental strand, 27028282 - 27028165
Alignment:
| Q |
18 |
attgacagtgctagaaaaccaacgccaaatattaatggcaaaagaacattccaagaacaaatgttgtgacgattcagacatacagttgtagagagagcac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27028282 |
attgacagtgctagaaaaccaacgccaaatattaatggcaaaagaacattccaagaacaaatgttgtgacgattcagacatacagttgtagagagagcac |
27028183 |
T |
|
| Q |
118 |
atagaggggagatggcaa |
135 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
27028182 |
atagaggggagatggcaa |
27028165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 133 - 273
Target Start/End: Complemental strand, 27028105 - 27027968
Alignment:
| Q |
133 |
caaagattttgagggagggaaatcaggagcccaaattagctaattagcccattccattttaggggatttttcttgaaatcataagcacctttcagagtta |
232 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
27028105 |
caaagattttgagggagggaaatcaggagaccaaattagct---tagcccatttcattttaggggatttttcttgaaatcataagcaccttacagattta |
27028009 |
T |
|
| Q |
233 |
actccccattattactatgcttccatattaatttatctctg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27028008 |
actccccattattactatgcttccatattaatttatctctg |
27027968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University