View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10559_high_16 (Length: 250)
Name: NF10559_high_16
Description: NF10559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10559_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 42578348 - 42578108
Alignment:
| Q |
1 |
tgttgtgagggtagttgtaaggggttagtgttgtgagggtagttgtagttccgatgactagttccgaggacaagcccagcagacttgatgatatctagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42578348 |
tgttgtgagggtagttgtaaggggttagtgttgtgagggtagttgtagttccgatgactagttccgaggacaagctcagcagacttgatgatatctagtt |
42578249 |
T |
 |
| Q |
101 |
gagactaataatacctggtggttccttccatctttttctattggta----aacagtcttgataaatgtattaaagtcgagttgatgaagaaaatctgctt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42578248 |
gagactaataatacctggtggttccttccatctttttctattggtaacctaacagtcttgataaatgtattaaagtcgagttgatgaagaaaatctgctt |
42578149 |
T |
 |
| Q |
197 |
atcctatcacattgtatattaagctcatctctttcctttct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42578148 |
atcctatcacattgtatattaagctcatctctttcctttct |
42578108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 77 - 116
Target Start/End: Complemental strand, 42571077 - 42571038
Alignment:
| Q |
77 |
cagcagacttgatgatatctagttgagactaataatacct |
116 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42571077 |
cagcagacttgttgatatctagttgagactaataatacct |
42571038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 47
Target Start/End: Complemental strand, 42578358 - 42578330
Alignment:
| Q |
19 |
aaggggttagtgttgtgagggtagttgta |
47 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42578358 |
aaggggttagtgttgtgagggtagttgta |
42578330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University