View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10559_high_23 (Length: 240)
Name: NF10559_high_23
Description: NF10559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10559_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 2377800 - 2378023
Alignment:
| Q |
1 |
tgggaatttcacccttgatataaccatcattgctcaggtaatttcactacaccgtcaccaaataataatcaatagaatatgtgactttaaaagtagttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2377800 |
tgggaatttcacccttgatataaccatcattgctcaggtaatttcactacaccgtcaccaaataataatcaatagaatatgtgactttaaaagtagttag |
2377899 |
T |
|
| Q |
101 |
gatgaaaactaaatatttttaatgatctcacgattatgattgattgaatatggaannnnnnnnncccgcaatttgcagatggatgtgggattttgcatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2377900 |
gatgaaaactaaatatttttaatgatctcacgattatgattgattgaatatggaa-ttttttttcccgcaatttgcagatggatgtgggattttgcatga |
2377998 |
T |
|
| Q |
201 |
cggtgaaggatcttgtgaggaagat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2377999 |
cggtgaaggatcttgtgaggaagat |
2378023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 168 - 219
Target Start/End: Complemental strand, 36766511 - 36766460
Alignment:
| Q |
168 |
gcaatttgcagatggatgtgggattttgcatgacggtgaaggatcttgtgag |
219 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
36766511 |
gcaatttgcagatggatgtggaattttgcatgacagtgaaggatcttgtgag |
36766460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 114 - 147
Target Start/End: Original strand, 33817355 - 33817388
Alignment:
| Q |
114 |
tatttttaatgatctcacgattatgattgattga |
147 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
33817355 |
tatttttaatgatctaacgattatgattgattga |
33817388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 114 - 147
Target Start/End: Complemental strand, 14004367 - 14004334
Alignment:
| Q |
114 |
tatttttaatgatctcacgattatgattgattga |
147 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
14004367 |
tattttaaatgatctcacgattatgattgattga |
14004334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 118 - 147
Target Start/End: Original strand, 15920245 - 15920274
Alignment:
| Q |
118 |
tttaatgatctcacgattatgattgattga |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15920245 |
tttaatgatctcacgattatgattgattga |
15920274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 111 - 147
Target Start/End: Original strand, 4624512 - 4624548
Alignment:
| Q |
111 |
aaatatttttaatgatctcacgattatgattgattga |
147 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
4624512 |
aaatatttttgatgatctgacgattatgattgattga |
4624548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 145
Target Start/End: Complemental strand, 49598485 - 49598417
Alignment:
| Q |
77 |
atatgtgactttaaaagtagttaggatgaaaactaaatatttttaatgatctcacgattatgattgatt |
145 |
Q |
| |
|
||||||||||||||||||||||| ||| || |||| ||||||||| |||| | ||||||||||||| |
|
|
| T |
49598485 |
atatgtgactttaaaagtagttacgattgaagttaaagatttttaataatctgataattatgattgatt |
49598417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University