View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10559_high_26 (Length: 224)
Name: NF10559_high_26
Description: NF10559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10559_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 11 - 209
Target Start/End: Complemental strand, 23279972 - 23279774
Alignment:
| Q |
11 |
agcataggtgtttgctttgtagattaagatatttagtgttgatggaagcatcatgnnnnnnnggtatctcattattgatatggttggtgttgctagggtt |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23279972 |
agcattggtgtttgctttgtagattaagatatttagtgttgatggaagcatcatgtttttttggtatctcattattgatatggttggtgttgctagggtt |
23279873 |
T |
 |
| Q |
111 |
taaaatgcaaaccggataatagtggatgcgacatcacttttagtgtatcaattgcgtttcggtcggagtttatgtactttgaattgaaagagtattata |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23279872 |
taaaatgcaaaccggataatagtggatgcgacatcacttttagtgtatcaattgcgtttcggtcggagtttatgtactttgaattgaaagagtattata |
23279774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 50
Target Start/End: Original strand, 23400543 - 23400582
Alignment:
| Q |
11 |
agcataggtgtttgctttgtagattaagatatttagtgtt |
50 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23400543 |
agcattggtgtttgctttgtagattaagatatttagtgtt |
23400582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University