View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10559_low_30 (Length: 319)
Name: NF10559_low_30
Description: NF10559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10559_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 158 - 297
Target Start/End: Complemental strand, 2768426 - 2768287
Alignment:
| Q |
158 |
gtgttcatttgaagtgaagccattcatttcaactctctccttttcaagagaacaaccacacaaagatcttcttaaacttgttactcagctcttcaaggtg |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2768426 |
gtgttcatttgaagtgaagccattcatttcaactctctccttttcaagagaacaaccacacaaagatcttcttaaacttgttactcagctcttcaaggtg |
2768327 |
T |
|
| Q |
258 |
atagtttaattctttcatgtttatcactattactacttca |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2768326 |
atagtttaattctttcatgtttatcactattactacttca |
2768287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 19 - 130
Target Start/End: Complemental strand, 2768565 - 2768454
Alignment:
| Q |
19 |
gtttaatggatcactaaattagagctgaaaaagtatcagtgcaagtcacatgcttatttatttttctatacatgaaagctcggtttttgaagaggtaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2768565 |
gtttaatggatcactaaattagagctgaaaaagtatcagtgcaagtcacatgcttatttatttttctatacatgaaagctcggtttttgaagaggtaaat |
2768466 |
T |
|
| Q |
119 |
taatattcactc |
130 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2768465 |
taatattcactc |
2768454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University