View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10559_low_41 (Length: 287)
Name: NF10559_low_41
Description: NF10559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10559_low_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 16954961 - 16954693
Alignment:
| Q |
1 |
gattaagaggatgatggaagatcaaagggcttctgagcaagaatttgagaaacaaatcaagcaattatcaccaaatctagtaggaactgaggatagtagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16954961 |
gattaagaggatgatggaagatcaaagggcttctgagcaagaatttgagaaacaaatcaagcaattatcaccaaatctagtaggaactgaggatagtagc |
16954862 |
T |
|
| Q |
101 |
aacaacaatttttcaaacaacagcactgttagggtttgtactgattgccacacaactaagacccctctctggagaagtggaccaactggtcccaaggtac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16954861 |
aacaacaatttttcaaacaacagcactgttagggtttgtactgattgccacacaactaagacccctctctggagaagtggaccaactggtcccaaggtac |
16954762 |
T |
|
| Q |
201 |
atattgctcacggattcttatattttttcatgataaataattgacttgttacattgtgcttctaatatg |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16954761 |
atattgctcacggattcttatattttttcatgataaataattgacttgttacattgtgcttctaatatg |
16954693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 129 - 185
Target Start/End: Original strand, 52565439 - 52565495
Alignment:
| Q |
129 |
ttagggtttgtactgattgccacacaactaagacccctctctggagaagtggaccaa |
185 |
Q |
| |
|
|||||||||| |||||||| |||| |||||||||||||||||||| |||||||||| |
|
|
| T |
52565439 |
ttagggtttgctctgattgcaacaccactaagacccctctctggaggagtggaccaa |
52565495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University