View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10559_low_46 (Length: 264)
Name: NF10559_low_46
Description: NF10559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10559_low_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 6e-46; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 156 - 257
Target Start/End: Complemental strand, 916802 - 916701
Alignment:
| Q |
156 |
tgaacagacaaagatgaatgaaagataccctactcattactcaagtacaacgttgatgtctttttgggcgtcacttctttctactatgtttgctctctgc |
255 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
916802 |
tgaacaggcaaagatgaatgaaagataccctactcattactcaagtacaacgttgatgtctttttgggcgtcacttctttctactatgtttgctctatgc |
916703 |
T |
|
| Q |
256 |
tt |
257 |
Q |
| |
|
|| |
|
|
| T |
916702 |
tt |
916701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 916955 - 916885
Alignment:
| Q |
1 |
attttgggttctctgtatgccttggttagtgccatctcttatgcattgtggcttattattcaggtattttg |
71 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
916955 |
attttgggttctctgtatgccatggttagtgccatctcttatgcattgtggcttattattcaggtattttg |
916885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 159 - 257
Target Start/End: Complemental strand, 1236775 - 1236677
Alignment:
| Q |
159 |
acagacaaagatgaatgaaagataccctactcattactcaagtacaacgttgatgtctttttgggcgtcacttctttctactatgtttgctctctgctt |
257 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||||||||| |||| | | || ||||||| ||||| |
|
|
| T |
1236775 |
acagacaaaaatgagtgaaagataccctactcattactcaagcacagcgttgatatctttttgggcgtcacttgtttccattgtgcttgctctatgctt |
1236677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 1236948 - 1236884
Alignment:
| Q |
1 |
attttgggttctctgtatgccttggttagtgccatctcttatgcattgtggcttattattcaggt |
65 |
Q |
| |
|
|||| ||||||||| | |||||||| |||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
1236948 |
atttcgggttctctatgtgccttggctagtagcatctcttatgcactttggcttattattcaggt |
1236884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University