View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10559_low_49 (Length: 252)
Name: NF10559_low_49
Description: NF10559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10559_low_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 9336808 - 9336584
Alignment:
| Q |
1 |
atcagaatggaaggatagtcgttttcattcgaaccgggaggtgcgaagtgaagtgaatatcgatttggcttctatctgtaaatccatcaccgatcctaag |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9336808 |
atcagaatggaaggatagtctttttcattcgaactgggaggtgcgaagtgaagcgaatatcgatttggcttctatctgtaaatccatcatcgatcctaag |
9336709 |
T |
|
| Q |
101 |
gatcttcgcatccttgaattcggttaatgtctcagtttttggtaggtagggtttttgcttttaacggtgatttgggtggagttagaactttgaatctgtt |
200 |
Q |
| |
|
|| | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9336708 |
gaccctcgcatccttgaattcggttaatgtttcagtttttggtaggtagggtttttgcttttaacggtgatttgggtggagttagaactttgaatctggt |
9336609 |
T |
|
| Q |
201 |
aggtcattttctcaaaaagactgtg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
9336608 |
aggtcattttctcaaaaagactgtg |
9336584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 126
Target Start/End: Complemental strand, 8209426 - 8209356
Alignment:
| Q |
56 |
aatatcgatttggcttctatctgtaaatccatcaccgatcctaaggatcttcgcatccttgaattcggtta |
126 |
Q |
| |
|
||||||||||| |||||| ||| | | ||||||||||||||||| |||| |||||| | | |||||||||| |
|
|
| T |
8209426 |
aatatcgatttagcttctctctttcactccatcaccgatcctaacgatcctcgcattcgtcaattcggtta |
8209356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 41 - 126
Target Start/End: Complemental strand, 42365268 - 42365183
Alignment:
| Q |
41 |
gtgcgaagtgaagtgaatatcgatttggcttctatctgtaaatccatcaccgatcctaaggatcttcgcatccttgaattcggtta |
126 |
Q |
| |
|
||||||| ||||| ||||| ||| |||||||| ||||| | || |||||||||||||| || | |||||||| |||||||||||| |
|
|
| T |
42365268 |
gtgcgaaatgaagccaatattgatctggcttctctctgtgactcaatcaccgatcctaaagaccctcgcatccgtgaattcggtta |
42365183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University